Gene detail

Detail information of GWHGAAZE026067

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010266772.1	2.81446E-72	PREDICTED: 40S ribosomal protein S11 [Nelumbo nucifera]
COG	YP_002428859.1	4E-31	30S ribosomal protein S17P
Swissprot	tr\|Q9M5M1\|RS11_EUPES	7E-69	40S ribosomal protein S11
trEMBL	tr\|B7FGL2\|B7FGL2_MEDTR	7E-70	Uncharacterized protein {ECO:0000313\|EMBL:AFK33686.1}
TAIR10	AT3G48930.1	1E-49	Nucleic acid-binding, OB-fold-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	72802212	72805132	+
GWHAAZE00000007	mRNA	72802212	72805132	+
GWHAAZE00000007	exon	72802212	72802223	+
GWHAAZE00000007	exon	72804262	72804419	+
GWHAAZE00000007	exon	72804859	72804948	+
GWHAAZE00000007	exon	72805039	72805132	+
GWHAAZE00000007	CDS	72802212	72802223	+
GWHAAZE00000007	CDS	72804262	72804419	+
GWHAAZE00000007	CDS	72804859	72804948	+
GWHAAZE00000007	CDS	72805039	72805132	+

Transcript Sequence
>GWHTAAZE026101 ATGGCGGAACAGTTGGATTTTGCAGGGACATATATTGATAAGAAATGCCCATTTACTGGCGATGTTTCCATTAGGGGTCGTATAATTGCTGGTACTTGCCACAGTGCCAAGATGGTGAGAACAATCATTGTGCGTCGTAACTACCTACATTATGTCAAGAAATACCAGAGGTATGAGAAGAGGCATTCAAACATTCCTGCACACGTATCCCCATGCTTCCGTGTGAAAGAAGGAGATCATGTTATTATTGGCCAATGCAGGCCATTGTCAAAGACGGTGAGATTCAACGTGCTGAAAGTCATCCCAGCTGGTTCATCTGGCGGTGGTGGTAAGAAGGCATTTACTGGTATATAA

Network for GWHGAAZE026067

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16205.6	Ribosomal_S17_N	8	29	3.50E-11
PF00366.21	Ribosomal_S17	31	99	3.20E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02949	RP-S11e, RPS11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	526.243
	SRR3591706	second leaf	210.365
	SRR3591707	mature leaf	152.639
	SRR3591708	Shoot apex	757.988
	SRR3591709	Stem	320.175
	SRR3591710	White floral bud	260.465
	SRR3591711	White flower	263.714
	SRR3591712	Green floral bud	468.266
	SRR3591713	Yellow flower	187.371
SRP173429	SRR8316895	Juvenile bud stage	236.238
	SRR8316896	Juvenile bud stage	368.998
	SRR8316897	Juvenile bud stage	176.428
	SRR8316894	Third green stage	140.823
	SRR8316900	Third green stage	420.460
	SRR8316901	Third green stage	415.156
	SRR8316898	Complete white stage	72.096
	SRR8316899	Complete white stage	393.438
	SRR8316903	Complete white stage	121.984
	SRR8316902	Silver flowering stage	77.565
	SRR8316904	Silver flowering stage	73.906
	SRR8316905	Silver flowering stage	39.133
	SRR8316906	Gold flowering stage	131.917
	SRR8316907	Gold flowering stage	112.425
	SRR8316908	Gold flowering stage	161.724
SRP132670	SRR6706286	Control	129.849
	SRR6706287	Light intensity 50%	152.345
	SRR6706288	Light intensity 20%	169.292
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	503.618
	CNS0095593	Slightly white alabastrum(diploid) 2	588.065
	CNS0095594	Slightly white alabastrum(diploid) 3	522.169
	CNS0095595	Whole white alabastrum(diploid) 2	432.005
	CNS0095596	Whole white alabastrum(diploid) 3	478.255
	CNS0095597	Whole white alabastrum(diploid) 4	366.821
	CNS0095598	Silvery flower (diploied) 1	244.900
	CNS0095599	Silvery flower (diploied) 2	232.984
	CNS0095600	Silvery flower (diploied) 3	159.110
	CNS0095601	Golden flower (diploid) 1	276.778
	CNS0095602	Golden flower (diploid) 2	177.074
	CNS0095603	Golden flower (diploid) 3	164.428
	CNS0095604	Slightly white alabastrum(tetraploid) 1	423.098
	CNS0095605	Slightly white alabastrum(tetraploid) 2	437.239
	CNS0095606	Slightly white alabastrum(tetraploid) 3	526.988
	CNS0095607	Whole white alabastrum(tetraploid) 1	267.119
	CNS0095608	Whole white alabastrum(tetraploid) 2	256.670
	CNS0095609	Whole white alabastrum(tetraploid) 3	404.864
	CNS0095610	Silvery flower (tetraploid) 1	174.857
	CNS0095611	Silvery flower (tetraploid) 2	136.126
	CNS0095612	Silvery flower (tetraploid) 3	109.037
	CNS0095613	Golden flower (tetraploid) 1	107.907
	CNS0095614	Golden flower (tetraploid) 2	137.596
	CNS0095615	Golden flower (tetraploid) 3	73.256
CRA001975	CRR073297	Stem 1	213.770
	CRR073298	Stem 2	218.108
	CRR073299	Stem 3	231.414
	CRR073300	Leaf 1	226.394
	CRR073301	Leaf 2	223.477
	CRR073302	Leaf 3	315.993
	CRR073303	Juvenile bud 1	220.311
	CRR073304	Juvenile bud 2	143.546
	CRR073305	Juvenile bud 3	171.745
	CRR073306	Third green 1	30.986
	CRR073307	Third green 2	38.171
	CRR073308	Third green 3	37.353
	CRR073309	Second white 1	43.687
	CRR073310	Second white 2	31.058
	CRR073311	Second white 3	20.494
	CRR073312	Silver flowering 1	27.007
	CRR073313	Silver flowering 2	39.097
	CRR073314	Silver flowering 3	26.100
	CRR073315	Gold flowering 1	98.458
	CRR073316	Gold flowering 2	97.197
	CRR073317	Gold flowering 3	90.857
	CRR073318	Tawny withering 1	212.346
	CRR073319	Tawny withering 2	226.997
	CRR073320	Tawny withering 3	224.442