Gene detail

Detail information of GWHGAAZE026037

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004136348.1	2.12876E-76	PREDICTED: ethylene-responsive transcription factor SHINE 3-like [Cucumis sativus]
Swissprot	tr\|Q3E958\|SHN3_ARATH	5E-67	Ethylene-responsive transcription factor SHINE 3
trEMBL	tr\|A0A0A0LJA8\|A0A0A0LJA8_CUCSA	8E-77	Uncharacterized protein {ECO:0000313\|EMBL:KGN60101.1}
TAIR10	AT5G25390.2	7E-43	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	72198124	72199804	-
GWHAAZE00000007	mRNA	72198124	72199804	-
GWHAAZE00000007	exon	72198124	72198619	-
GWHAAZE00000007	exon	72199725	72199804	-
GWHAAZE00000007	CDS	72199725	72199804	-
GWHAAZE00000007	CDS	72198124	72198619	-

Transcript Sequence
>GWHTAAZE026071 ATGGTACAATCAAAGAAGTTCAGAGGTGTCAGGCAGCGCCAGTGGGGTTCCTGGGTGGCCGAAATTCGCCACCCATTGCTAAAGAGAAGAATTTGGATAGGCACATTTGAGACAGCTGAGGCAGCAGCAAGAGCATATGACCAAGCAGCCATCTTAATGAATGGCCAAAATGCCAAGACTAATTTTCCGGCGACACCTCAAAACGCTACAGGAAATTCCCCTCTGGCGGCATCTCCAGCAGAATTTTCTGGCTCACTCAGCGCTAAGCTCCGAAAATGCATTAGGGACCACCCAGCGCCTTCTCTTACTTGCCTAAGGCTCGACTCCGATAATTCCCACATCGGAGTGTGGCAAAACCGAGCGGGAGGCCGCGGCTCGGGATCAAACTGGGTGACCAGAGTCGAGCTAGGAAATAAGAAAAAGTCGCCGGAGGAATCTCCGTCTCCGGAGAATGATGAGATGGATGAAGAGAATAGAAACGCAATGCAAATGATTGAGGAGTTACTCAATTGGAATACTTCAATGCCTTCACTTCTTGGAGTCAATGAAGTAGTCAAAGGTCCTTTGTATGTTTAA

Network for GWHGAAZE026037

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	6	55	5.10E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.844
	SRR3591706	second leaf	44.743
	SRR3591707	mature leaf	7.813
	SRR3591708	Shoot apex	97.466
	SRR3591709	Stem	2.175
	SRR3591710	White floral bud	3.297
	SRR3591711	White flower	1.958
	SRR3591712	Green floral bud	9.845
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	18.204
	SRR8316896	Juvenile bud stage	18.078
	SRR8316897	Juvenile bud stage	5.370
	SRR8316894	Third green stage	5.392
	SRR8316900	Third green stage	6.991
	SRR8316901	Third green stage	9.187
	SRR8316898	Complete white stage	0.242
	SRR8316899	Complete white stage	13.951
	SRR8316903	Complete white stage	1.953
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.087
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.134
SRP132670	SRR6706286	Control	12.611
	SRR6706287	Light intensity 50%	13.250
	SRR6706288	Light intensity 20%	13.586
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.466
	CNS0095593	Slightly white alabastrum(diploid) 2	12.257
	CNS0095594	Slightly white alabastrum(diploid) 3	9.535
	CNS0095595	Whole white alabastrum(diploid) 2	10.974
	CNS0095596	Whole white alabastrum(diploid) 3	6.051
	CNS0095597	Whole white alabastrum(diploid) 4	6.726
	CNS0095598	Silvery flower (diploied) 1	11.829
	CNS0095599	Silvery flower (diploied) 2	17.322
	CNS0095600	Silvery flower (diploied) 3	1.791
	CNS0095601	Golden flower (diploid) 1	11.616
	CNS0095602	Golden flower (diploid) 2	4.531
	CNS0095603	Golden flower (diploid) 3	4.764
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.946
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.971
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.589
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.115
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.049
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.157
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	1.712
	CNS0095612	Silvery flower (tetraploid) 3	1.652
	CNS0095613	Golden flower (tetraploid) 1	0.127
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.096
CRA001975	CRR073297	Stem 1	26.243
	CRR073298	Stem 2	23.586
	CRR073299	Stem 3	16.724
	CRR073300	Leaf 1	21.245
	CRR073301	Leaf 2	23.007
	CRR073302	Leaf 3	20.799
	CRR073303	Juvenile bud 1	10.171
	CRR073304	Juvenile bud 2	2.682
	CRR073305	Juvenile bud 3	8.676
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.130
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	11.784
	CRR073316	Gold flowering 2	6.479
	CRR073317	Gold flowering 3	5.541
	CRR073318	Tawny withering 1	22.957
	CRR073319	Tawny withering 2	19.973
	CRR073320	Tawny withering 3	27.355