Gene detail

Detail information of GWHGAAZE026009

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDY06600.1	1.9822E-146	BnaC02g13240D [Brassica napus]
COG	YP_007376943.1	1E-14	small GTP-binding protein domain-containing protein, Ras family
Swissprot	tr\|Q8H156\|RAN3_ARATH	2E-146	GTP-binding nuclear protein Ran-3
trEMBL	tr\|A0A078EX10\|A0A078EX10_BRANA	7E-147	BnaC02g13240D protein {ECO:0000313\|EMBL:CDY06600.1}
TAIR10	AT5G55190.1	3E-115	RAN GTPase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	71779766	71781920	+
GWHAAZE00000007	mRNA	71779766	71781920	+
GWHAAZE00000007	exon	71779766	71779835	+
GWHAAZE00000007	exon	71780638	71780694	+
GWHAAZE00000007	exon	71780804	71780921	+
GWHAAZE00000007	exon	71781364	71781453	+
GWHAAZE00000007	exon	71781560	71781739	+
GWHAAZE00000007	exon	71781839	71781920	+
GWHAAZE00000007	CDS	71779766	71779835	+
GWHAAZE00000007	CDS	71780638	71780694	+
GWHAAZE00000007	CDS	71780804	71780921	+
GWHAAZE00000007	CDS	71781364	71781453	+
GWHAAZE00000007	CDS	71781560	71781739	+
GWHAAZE00000007	CDS	71781839	71781920	+

Transcript Sequence
>GWHTAAZE026043 GCTTTGCCGAATCAGCAAACTGTTGAATATCCGAGTTTCAAGCTCGTAATCGTTGGCGATGGTGGAACAGGCAAAACTACATTTGTGAAGAGACATCTTACTGGAGAATTTGAGAAGAAATATGAACCAACCATTGGCGTGGAAGTTCATCCACTAGATTTCTTCACCAATTGCGGGAAAGTTAGGTTCTACTGCTGGGACACAGCTGGGCAGGAGAAATTTGGTGGTCTTAGGGATGGTTACTACATTCATGGACAGTGTGCCATCATCATGTTTGATGTAACAGCGAGGCTTACTTACAAGAATGTCCCGACATGGCATCGGGATCTCTGCCGAGTGTGCGAGAATATCCCAATTGTACTTTGTGGGAACAAGGTTGACGTGAAGAACCGTCAGGTGAAGGCAAAGCAGGTTACTTTCCACCGGAAGAAGAATTTACAGTACTACGAGATATCAGCAAAGAGCAACTACAACTTTGAGAAGCCTTTTCTCTACCTTGCTAGAAAGCTTGCTGGGGATCCTAACTTGCATTTTGTGGAGTCACCTGCCCTTGCTCCTCCAGAAGTTCAGATCGACATGGCTCAACAACAGCAGTAA

Network for GWHGAAZE026009

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	14	170	3.90E-50

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07936	RAN	RNA transport	map03013
K07936	RAN	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0006913	biological_process	nucleocytoplasmic transport
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	408.642
	SRR3591706	second leaf	166.266
	SRR3591707	mature leaf	131.385
	SRR3591708	Shoot apex	290.805
	SRR3591709	Stem	283.879
	SRR3591710	White floral bud	267.157
	SRR3591711	White flower	514.960
	SRR3591712	Green floral bud	332.615
	SRR3591713	Yellow flower	335.225
SRP173429	SRR8316895	Juvenile bud stage	246.686
	SRR8316896	Juvenile bud stage	326.152
	SRR8316897	Juvenile bud stage	175.230
	SRR8316894	Third green stage	130.796
	SRR8316900	Third green stage	488.983
	SRR8316901	Third green stage	398.395
	SRR8316898	Complete white stage	162.268
	SRR8316899	Complete white stage	508.392
	SRR8316903	Complete white stage	237.627
	SRR8316902	Silver flowering stage	314.440
	SRR8316904	Silver flowering stage	303.960
	SRR8316905	Silver flowering stage	132.395
	SRR8316906	Gold flowering stage	394.608
	SRR8316907	Gold flowering stage	421.887
	SRR8316908	Gold flowering stage	441.322
SRP132670	SRR6706286	Control	438.181
	SRR6706287	Light intensity 50%	467.344
	SRR6706288	Light intensity 20%	500.069
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	283.714
	CNS0095593	Slightly white alabastrum(diploid) 2	297.245
	CNS0095594	Slightly white alabastrum(diploid) 3	244.469
	CNS0095595	Whole white alabastrum(diploid) 2	249.071
	CNS0095596	Whole white alabastrum(diploid) 3	269.657
	CNS0095597	Whole white alabastrum(diploid) 4	198.441
	CNS0095598	Silvery flower (diploied) 1	323.314
	CNS0095599	Silvery flower (diploied) 2	278.063
	CNS0095600	Silvery flower (diploied) 3	452.081
	CNS0095601	Golden flower (diploid) 1	259.308
	CNS0095602	Golden flower (diploid) 2	370.150
	CNS0095603	Golden flower (diploid) 3	363.373
	CNS0095604	Slightly white alabastrum(tetraploid) 1	289.898
	CNS0095605	Slightly white alabastrum(tetraploid) 2	268.455
	CNS0095606	Slightly white alabastrum(tetraploid) 3	441.739
	CNS0095607	Whole white alabastrum(tetraploid) 1	187.655
	CNS0095608	Whole white alabastrum(tetraploid) 2	164.933
	CNS0095609	Whole white alabastrum(tetraploid) 3	359.419
	CNS0095610	Silvery flower (tetraploid) 1	555.259
	CNS0095611	Silvery flower (tetraploid) 2	463.030
	CNS0095612	Silvery flower (tetraploid) 3	307.017
	CNS0095613	Golden flower (tetraploid) 1	252.841
	CNS0095614	Golden flower (tetraploid) 2	365.498
	CNS0095615	Golden flower (tetraploid) 3	322.743
CRA001975	CRR073297	Stem 1	412.313
	CRR073298	Stem 2	412.169
	CRR073299	Stem 3	532.216
	CRR073300	Leaf 1	402.768
	CRR073301	Leaf 2	450.089
	CRR073302	Leaf 3	588.254
	CRR073303	Juvenile bud 1	553.508
	CRR073304	Juvenile bud 2	357.679
	CRR073305	Juvenile bud 3	460.936
	CRR073306	Third green 1	214.795
	CRR073307	Third green 2	241.664
	CRR073308	Third green 3	226.768
	CRR073309	Second white 1	277.641
	CRR073310	Second white 2	229.946
	CRR073311	Second white 3	169.958
	CRR073312	Silver flowering 1	192.305
	CRR073313	Silver flowering 2	246.843
	CRR073314	Silver flowering 3	202.995
	CRR073315	Gold flowering 1	257.535
	CRR073316	Gold flowering 2	279.255
	CRR073317	Gold flowering 3	195.025
	CRR073318	Tawny withering 1	511.023
	CRR073319	Tawny withering 2	461.927
	CRR073320	Tawny withering 3	514.243