Gene detail

Detail information of GWHGAAZE025913

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249578.1	3.56273E-62	PREDICTED: dehydration-responsive element-binding protein 3-like [Nelumbo nucifera]
Swissprot	tr\|Q39127\|TINY_ARATH	2E-50	Ethylene-responsive transcription factor TINY
trEMBL	tr\|A0A061GK29\|A0A061GK29_THECC	1E-60	Integrase-type DNA-binding superfamily protein {ECO:0000313\|EMBL:EOY29748.1}
TAIR10	AT5G11590.1	2E-35	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	70168659	70169165	-
GWHAAZE00000007	mRNA	70168659	70169165	-
GWHAAZE00000007	exon	70168659	70169165	-
GWHAAZE00000007	CDS	70168659	70169165	-

Transcript Sequence
>GWHTAAZE025947 ATGAGAAACTGGGGCAAATGGGTATCCGAAATCCGGGAGCCCCGGAAGAAATCCCGAATCTGGCTTGGCACCTTCACCACTCCCGAGATGGCGGCGCGTGCACACGACGTAGCCGCCATCAGCATTAAAGGCAAGTCGGCTATCCTCAATTTCCCCGAACTATCCGGGTCCTTGCCCCAACCTGAATCTCTCTCCCCACGCGACATTCAAGCAGCCGCCGCCAAAGCCGCCGCCATGGAGGAATTAAACCCGCCGCAGAGTGAGGAACTGGGGAGTGCAGGCGAGGAATTGGGCGATTTTTTGGAGTTGCCGAGTTTGGGGAATTGTTTTGATTCACTGGAGTTGGATAGGGATTTCGTGTACGTTGATTCTGCAGAAGGGTGGTTCTATCCTGCCCCGTGGGTGAATGGTATTGATGATCGTGGTGGGTTTTTTTCCGAGGGGTTGCCTGCGCCGGCCGAGAGTGTGATTTCTAGTAGCTTTGAGTCTTTGTTGTGGGATTATTAA

Network for GWHGAAZE025913

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	3	44	1.60E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.051
	SRR3591706	second leaf	15.485
	SRR3591707	mature leaf	16.885
	SRR3591708	Shoot apex	22.118
	SRR3591709	Stem	15.606
	SRR3591710	White floral bud	1.973
	SRR3591711	White flower	4.150
	SRR3591712	Green floral bud	2.482
	SRR3591713	Yellow flower	0.157
SRP173429	SRR8316895	Juvenile bud stage	0.770
	SRR8316896	Juvenile bud stage	0.899
	SRR8316897	Juvenile bud stage	0.106
	SRR8316894	Third green stage	1.348
	SRR8316900	Third green stage	0.793
	SRR8316901	Third green stage	1.691
	SRR8316898	Complete white stage	0.166
	SRR8316899	Complete white stage	2.921
	SRR8316903	Complete white stage	0.383
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.741
	SRR6706287	Light intensity 50%	1.274
	SRR6706288	Light intensity 20%	1.439
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.609
	CNS0095593	Slightly white alabastrum(diploid) 2	2.861
	CNS0095594	Slightly white alabastrum(diploid) 3	1.774
	CNS0095595	Whole white alabastrum(diploid) 2	1.126
	CNS0095596	Whole white alabastrum(diploid) 3	0.615
	CNS0095597	Whole white alabastrum(diploid) 4	1.945
	CNS0095598	Silvery flower (diploied) 1	8.193
	CNS0095599	Silvery flower (diploied) 2	5.774
	CNS0095600	Silvery flower (diploied) 3	1.824
	CNS0095601	Golden flower (diploid) 1	9.502
	CNS0095602	Golden flower (diploid) 2	3.746
	CNS0095603	Golden flower (diploid) 3	4.735
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.528
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.473
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.639
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.053
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.435
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.171
	CNS0095610	Silvery flower (tetraploid) 1	0.107
	CNS0095611	Silvery flower (tetraploid) 2	2.370
	CNS0095612	Silvery flower (tetraploid) 3	0.408
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.089
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.097
	CRR073298	Stem 2	1.352
	CRR073299	Stem 3	3.113
	CRR073300	Leaf 1	1.246
	CRR073301	Leaf 2	2.762
	CRR073302	Leaf 3	0.627
	CRR073303	Juvenile bud 1	0.357
	CRR073304	Juvenile bud 2	0.264
	CRR073305	Juvenile bud 3	1.617
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.187
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.457
	CRR073316	Gold flowering 2	1.742
	CRR073317	Gold flowering 3	2.118
	CRR073318	Tawny withering 1	14.497
	CRR073319	Tawny withering 2	1.266
	CRR073320	Tawny withering 3	16.104