Gene detail

Detail information of GWHGAAZE025896

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAD43177.2	3.9799E-137	putative cyclin dependent kinase [Coffea arabica]
COG	YP_002560205.1	2E-17	hypothetical protein MCCL_0802
Swissprot	tr\|Q38772\|CDC2A_ANTMA	3E-136	Cell division control protein 2 homolog A
trEMBL	tr\|Q8L6U7\|Q8L6U7_COFAR	1E-137	Putative cyclin dependent kinase {ECO:0000313\|EMBL:CAD43177.2}
TAIR10	AT3G48750.1	4E-97	cell division control 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	69785641	69790676	+
GWHAAZE00000007	mRNA	69785641	69790676	+
GWHAAZE00000007	exon	69785641	69785736	+
GWHAAZE00000007	exon	69786483	69786656	+
GWHAAZE00000007	exon	69788905	69789068	+
GWHAAZE00000007	exon	69789886	69789973	+
GWHAAZE00000007	exon	69790064	69790117	+
GWHAAZE00000007	exon	69790587	69790676	+
GWHAAZE00000007	CDS	69785641	69785736	+
GWHAAZE00000007	CDS	69786483	69786656	+
GWHAAZE00000007	CDS	69788905	69789068	+
GWHAAZE00000007	CDS	69789886	69789973	+
GWHAAZE00000007	CDS	69790064	69790117	+
GWHAAZE00000007	CDS	69790587	69790676	+

Transcript Sequence
>GWHTAAZE025930 ATGGACACGTGTCCAGAGTTTGCAAAGGATCCACGTCTGATAAAAGTGAGTGAGCTCTTTCTGCCTCTTAGAGGTGGTGCAACTTGTGCTACAGGAATGTTTTTGTATCAAATACTTCGTGGCATTGCTTATTGTCATTCTCATAGAGTTCTTCATCGGGATTTGAAGCCTCAGAACTTGCTGATAGATCGTAAGACCAATGCGCTAAAGCTTGCTGACTTTGGATTGGCTAGAGCATTTGGTATTCCTGTGAGGACATTTACACATGAGGTGGTGACATTATGGTATAGAGCACCTGAAATATTGCTTGGATCCCGCAACTATTCTACTCCGGTGGATATGTGGTCCGTTGGCTGTATATTTGCTGAGATGGTGAACCAACGCCCATTGTTTCCTGGGGACTCAGAGATTGACGAATTGTTTAAGATTTTCAGAATCATGGGTACTCCAAATGAGGATACATGGCCAGGAGTGACATCTCTGCCTGATTTTAAATCTGCCTTTCCAAAGTGGCTTCCTAAGGAGCTATCAACTGTTGTCCCAAATCTTGATTCCACTGGTCTCGATCTCCTTAGTAAAATGCTGTGCTTGGATCCAAGCAGAAGAGTTACGGCAAGGAATGCTCTCGAGCACGAATACTTCAAGGACATCGGGTTTGTACCATAA

Network for GWHGAAZE025896

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	31	214	1.10E-51

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CMGC_CDK-Pl

KEGG pathway

KO	Enzyme	pathway	mapID
K02206	CDK2	FoxO signaling pathway	map04068
		PI3K-Akt signaling pathway	map04151
		Cell cycle	map04110
		Oocyte meiosis	map04114
		p53 signaling pathway	map04115
		Cellular senescence	map04218
		Progesterone-mediated oocyte maturation	map04914

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	56.937
	SRR3591706	second leaf	37.475
	SRR3591707	mature leaf	24.696
	SRR3591708	Shoot apex	58.022
	SRR3591709	Stem	45.600
	SRR3591710	White floral bud	43.066
	SRR3591711	White flower	36.491
	SRR3591712	Green floral bud	62.713
	SRR3591713	Yellow flower	28.304
SRP173429	SRR8316895	Juvenile bud stage	28.889
	SRR8316896	Juvenile bud stage	37.045
	SRR8316897	Juvenile bud stage	20.088
	SRR8316894	Third green stage	15.445
	SRR8316900	Third green stage	49.321
	SRR8316901	Third green stage	51.553
	SRR8316898	Complete white stage	19.125
	SRR8316899	Complete white stage	67.361
	SRR8316903	Complete white stage	24.162
	SRR8316902	Silver flowering stage	12.312
	SRR8316904	Silver flowering stage	19.120
	SRR8316905	Silver flowering stage	8.093
	SRR8316906	Gold flowering stage	21.361
	SRR8316907	Gold flowering stage	22.569
	SRR8316908	Gold flowering stage	17.329
SRP132670	SRR6706286	Control	15.306
	SRR6706287	Light intensity 50%	20.937
	SRR6706288	Light intensity 20%	23.015
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.995
	CNS0095593	Slightly white alabastrum(diploid) 2	42.847
	CNS0095594	Slightly white alabastrum(diploid) 3	37.494
	CNS0095595	Whole white alabastrum(diploid) 2	41.037
	CNS0095596	Whole white alabastrum(diploid) 3	43.070
	CNS0095597	Whole white alabastrum(diploid) 4	38.620
	CNS0095598	Silvery flower (diploied) 1	27.482
	CNS0095599	Silvery flower (diploied) 2	26.597
	CNS0095600	Silvery flower (diploied) 3	34.329
	CNS0095601	Golden flower (diploid) 1	26.018
	CNS0095602	Golden flower (diploid) 2	26.774
	CNS0095603	Golden flower (diploid) 3	25.223
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.764
	CNS0095605	Slightly white alabastrum(tetraploid) 2	44.549
	CNS0095606	Slightly white alabastrum(tetraploid) 3	55.085
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.707
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.969
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.439
	CNS0095610	Silvery flower (tetraploid) 1	28.148
	CNS0095611	Silvery flower (tetraploid) 2	38.677
	CNS0095612	Silvery flower (tetraploid) 3	27.561
	CNS0095613	Golden flower (tetraploid) 1	18.064
	CNS0095614	Golden flower (tetraploid) 2	24.070
	CNS0095615	Golden flower (tetraploid) 3	19.228
CRA001975	CRR073297	Stem 1	38.851
	CRR073298	Stem 2	42.047
	CRR073299	Stem 3	37.901
	CRR073300	Leaf 1	48.286
	CRR073301	Leaf 2	43.144
	CRR073302	Leaf 3	55.954
	CRR073303	Juvenile bud 1	55.161
	CRR073304	Juvenile bud 2	35.959
	CRR073305	Juvenile bud 3	49.036
	CRR073306	Third green 1	18.207
	CRR073307	Third green 2	21.022
	CRR073308	Third green 3	17.064
	CRR073309	Second white 1	21.358
	CRR073310	Second white 2	11.293
	CRR073311	Second white 3	7.224
	CRR073312	Silver flowering 1	13.562
	CRR073313	Silver flowering 2	14.725
	CRR073314	Silver flowering 3	11.655
	CRR073315	Gold flowering 1	25.797
	CRR073316	Gold flowering 2	28.044
	CRR073317	Gold flowering 3	28.701
	CRR073318	Tawny withering 1	45.377
	CRR073319	Tawny withering 2	28.185
	CRR073320	Tawny withering 3	46.580