Gene detail

Detail information of GWHGAAZE025856

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP33947.1	8.65537E-81	hypothetical protein JCGZ_07518 [Jatropha curcas]
Swissprot	tr\|Q84QC2\|ERF17_ARATH	6E-59	Ethylene-responsive transcription factor ERF017
trEMBL	tr\|A0A067KCS8\|A0A067KCS8_JATCU	3E-81	Uncharacterized protein {ECO:0000313\|EMBL:KDP33947.1}
TAIR10	AT1G19210.1	2E-44	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	68951522	68952199	-
GWHAAZE00000007	mRNA	68951522	68952199	-
GWHAAZE00000007	exon	68951522	68952199	-
GWHAAZE00000007	CDS	68951522	68952199	-

Transcript Sequence
>GWHTAAZE025890 ATGGTGAAACCTGAAAGCCAATCACAGGCCGAGACAAGTAGTGGCTCCAAGTATAAAGGCGTGCGCAAGCGTAAATGGGGCAAGTACGTGTCCGAAATCCGCCTCCCCAATAGCCGGGAGCGGATTTGGTTGGGTTCCTATGATACCCCAGAGAAGGCGGCGCGTGCATTTGATGCCGCCTTATTTTGCTTGCGTGGCCACTCGGCCAAGTTTAACTTCCCCGATAACCCGCCTGATATCTCCGGCGGAAGGTCGCTCTCTCCACCAGACATACAGGCTGCGGCAGCCCGCTTTGCAAATTCTGAGCCGCTACCTCCTCCGCGAGTTGGTCATTTGGTTACTAATAATGATAGTAATAATCAAATGACTAACTCGTGCTCTTCCTCCTCGTCATCTGAAATGCGGGTGGAGTCTCCTACTCCGTCTGCAGTTTCAGATGGTGCGGCGCAGCTGGATACTGACATGGGACACGACGCCTCATTTATCGATCATTTTTCAACAATGGGTTCCGGGATTACAATGGGATCAGGGAGTAATGTGCCAGATTTCGGCATTTTTCCGGGATTTGATGACCTTAATAACGATTTTTTCATGCCACCATTGCCTCCTAGTGTTGATTACGGGGAAGAGAATTGTGACGGAGTTTACCAACAAGAATCATTCCTTTGGAATTTTTAA

Network for GWHGAAZE025856

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	16	67	1.20E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.232
	SRR3591706	second leaf	2.375
	SRR3591707	mature leaf	1.068
	SRR3591708	Shoot apex	5.475
	SRR3591709	Stem	28.563
	SRR3591710	White floral bud	13.524
	SRR3591711	White flower	18.034
	SRR3591712	Green floral bud	3.557
	SRR3591713	Yellow flower	1.025
SRP173429	SRR8316895	Juvenile bud stage	24.000
	SRR8316896	Juvenile bud stage	0.637
	SRR8316897	Juvenile bud stage	7.983
	SRR8316894	Third green stage	2.037
	SRR8316900	Third green stage	1.510
	SRR8316901	Third green stage	2.768
	SRR8316898	Complete white stage	0.120
	SRR8316899	Complete white stage	23.559
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.562
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.486
	SRR6706287	Light intensity 50%	0.295
	SRR6706288	Light intensity 20%	0.140
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.084
	CNS0095593	Slightly white alabastrum(diploid) 2	42.976
	CNS0095594	Slightly white alabastrum(diploid) 3	18.822
	CNS0095595	Whole white alabastrum(diploid) 2	25.533
	CNS0095596	Whole white alabastrum(diploid) 3	0.596
	CNS0095597	Whole white alabastrum(diploid) 4	21.011
	CNS0095598	Silvery flower (diploied) 1	118.433
	CNS0095599	Silvery flower (diploied) 2	124.597
	CNS0095600	Silvery flower (diploied) 3	27.387
	CNS0095601	Golden flower (diploid) 1	103.826
	CNS0095602	Golden flower (diploid) 2	57.996
	CNS0095603	Golden flower (diploid) 3	53.356
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.047
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.351
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	2.746
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.092
CRA001975	CRR073297	Stem 1	3.518
	CRR073298	Stem 2	3.021
	CRR073299	Stem 3	4.978
	CRR073300	Leaf 1	2.331
	CRR073301	Leaf 2	7.605
	CRR073302	Leaf 3	1.884
	CRR073303	Juvenile bud 1	4.329
	CRR073304	Juvenile bud 2	22.277
	CRR073305	Juvenile bud 3	10.104
	CRR073306	Third green 1	0.348
	CRR073307	Third green 2	0.485
	CRR073308	Third green 3	0.150
	CRR073309	Second white 1	0.234
	CRR073310	Second white 2	0.067
	CRR073311	Second white 3	0.229
	CRR073312	Silver flowering 1	1.048
	CRR073313	Silver flowering 2	0.172
	CRR073314	Silver flowering 3	1.118
	CRR073315	Gold flowering 1	2.884
	CRR073316	Gold flowering 2	7.373
	CRR073317	Gold flowering 3	9.369
	CRR073318	Tawny withering 1	1.870
	CRR073319	Tawny withering 2	39.758
	CRR073320	Tawny withering 3	10.334