Gene detail

Detail information of GWHGAAZE025813

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007012386.1	7.96886E-75	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein isoform 2 [Theobroma cacao]
COG	YP_007944453.1	7E-32	putative amidohydrolase
Swissprot	tr\|Q8RUF8\|NILP3_ARATH	3E-64	Omega-amidase,chloroplastic (Precursor)
trEMBL	tr\|W9QPM2\|W9QPM2_9ROSA	7E-76	Omega-amidase NIT2-B {ECO:0000313\|EMBL:EXB48285.1}
TAIR10	AT5G12040.2	7E-54	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	68266503	68269921	+
GWHAAZE00000007	mRNA	68266503	68269921	+
GWHAAZE00000007	exon	68266503	68266742	+
GWHAAZE00000007	exon	68267557	68267713	+
GWHAAZE00000007	exon	68269058	68269132	+
GWHAAZE00000007	exon	68269401	68269479	+
GWHAAZE00000007	exon	68269894	68269921	+
GWHAAZE00000007	CDS	68266503	68266742	+
GWHAAZE00000007	CDS	68267557	68267713	+
GWHAAZE00000007	CDS	68269058	68269132	+
GWHAAZE00000007	CDS	68269401	68269479	+
GWHAAZE00000007	CDS	68269894	68269921	+

Transcript Sequence
>GWHTAAZE025847 ATGCTTGGTACTAATCTGCGTAAATTAGAACTTACAATACTTTGTGAACACGTTGTCAATGGTAGAAATGATTTGTGGATGGTTGCTAAAGTTATTATAAATTGTCTCTCTCCTCAATTTCAGTTCAAGATCAGTCTTTGCCAGTTGCCAGTAACTGCGGACAAGGAGAGAAACATCAGGCATGCTAGAAAATCGATTGAGGAGGCTGCAGAAAAGGGTGCTCAACTTGTTCTTCTTCCAGAAATATGGAACACTCCTTATTCAAATGACAATTTACCAGGATATGCAGAGGATATTGATGCTGGCGGTGATGCTTCTCCTTCAACTGCAATGTTGTCTGAAGTTTCCCTTAGGCATCAGATCACAATAGTTGGTGGCTCTATACCTGAGCGCTCTGATGTTGGGCGTATTGGTATAGGTATATGCTATGATATTCGATTTCAAGAACTTGCAGCTTTGTATGCCGCAAGAGGTGCTCACTTACTCTGCTATCCTGGGGCATTTAACATGACTACTGGTCCATTGCATTGGGAGCTATTGCAGAGGGCAAGGGGGGCGGATTATCAGGTATTTTTTTAA

Network for GWHGAAZE025813

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00795.23	CN_hydrolase	43	130	1.50E-13
PF00795.23	CN_hydrolase	132	191	1.30E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13566	NIT2, yafV	Metabolic pathways	map01100
K13566	NIT2, yafV	Alanine, aspartate and glutamate metabolism	map00250

Gene Ontology

GO term	Ontology	Name
GO:0006807	biological_process	nitrogen compound metabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.791
	SRR3591706	second leaf	2.679
	SRR3591707	mature leaf	1.900
	SRR3591708	Shoot apex	5.398
	SRR3591709	Stem	2.720
	SRR3591710	White floral bud	1.279
	SRR3591711	White flower	1.783
	SRR3591712	Green floral bud	3.421
	SRR3591713	Yellow flower	0.708
SRP173429	SRR8316895	Juvenile bud stage	3.530
	SRR8316896	Juvenile bud stage	4.520
	SRR8316897	Juvenile bud stage	1.674
	SRR8316894	Third green stage	2.127
	SRR8316900	Third green stage	4.223
	SRR8316901	Third green stage	4.671
	SRR8316898	Complete white stage	0.563
	SRR8316899	Complete white stage	3.475
	SRR8316903	Complete white stage	1.207
	SRR8316902	Silver flowering stage	0.046
	SRR8316904	Silver flowering stage	0.691
	SRR8316905	Silver flowering stage	0.260
	SRR8316906	Gold flowering stage	1.096
	SRR8316907	Gold flowering stage	0.750
	SRR8316908	Gold flowering stage	0.477
SRP132670	SRR6706286	Control	3.249
	SRR6706287	Light intensity 50%	3.278
	SRR6706288	Light intensity 20%	3.903
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.202
	CNS0095593	Slightly white alabastrum(diploid) 2	2.432
	CNS0095594	Slightly white alabastrum(diploid) 3	2.431
	CNS0095595	Whole white alabastrum(diploid) 2	3.451
	CNS0095596	Whole white alabastrum(diploid) 3	3.906
	CNS0095597	Whole white alabastrum(diploid) 4	3.203
	CNS0095598	Silvery flower (diploied) 1	2.511
	CNS0095599	Silvery flower (diploied) 2	2.756
	CNS0095600	Silvery flower (diploied) 3	1.929
	CNS0095601	Golden flower (diploid) 1	2.469
	CNS0095602	Golden flower (diploid) 2	1.422
	CNS0095603	Golden flower (diploid) 3	0.822
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.065
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.211
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.551
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.523
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.527
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.846
	CNS0095610	Silvery flower (tetraploid) 1	0.494
	CNS0095611	Silvery flower (tetraploid) 2	1.611
	CNS0095612	Silvery flower (tetraploid) 3	1.301
	CNS0095613	Golden flower (tetraploid) 1	0.222
	CNS0095614	Golden flower (tetraploid) 2	1.008
	CNS0095615	Golden flower (tetraploid) 3	0.022
CRA001975	CRR073297	Stem 1	3.773
	CRR073298	Stem 2	3.253
	CRR073299	Stem 3	1.170
	CRR073300	Leaf 1	2.376
	CRR073301	Leaf 2	2.087
	CRR073302	Leaf 3	0.736
	CRR073303	Juvenile bud 1	0.614
	CRR073304	Juvenile bud 2	0.392
	CRR073305	Juvenile bud 3	1.010
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.074
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.739
	CRR073316	Gold flowering 2	0.909
	CRR073317	Gold flowering 3	0.262
	CRR073318	Tawny withering 1	1.160
	CRR073319	Tawny withering 2	0.829
	CRR073320	Tawny withering 3	0.354