Gene detail

Detail information of GWHGAAZE025674

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10286.1	8.9844E-128	unnamed protein product [Coffea canephora]
COG	YP_002429069.1	8E-17	DNA-directed RNA polymerase subunit H
Swissprot	tr\|O81098\|RPB5A_ARATH	9E-124	DNA-directed RNA polymerases II and IV subunit 5A
trEMBL	tr\|A0A068UPE2\|A0A068UPE2_COFCA	3E-128	Coffea canephora DH200=94 genomic scaffold, scaffold_44 {ECO:0000313\|EMBL:CDP10286.1}
TAIR10	AT3G22320.1	3E-91	Eukaryotic rpb5 RNA polymerase subunit family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65772826	65776878	+
GWHAAZE00000007	mRNA	65772826	65776878	+
GWHAAZE00000007	exon	65772826	65773026	+
GWHAAZE00000007	exon	65774699	65774878	+
GWHAAZE00000007	exon	65775547	65775660	+
GWHAAZE00000007	exon	65776753	65776878	+
GWHAAZE00000007	CDS	65772826	65773026	+
GWHAAZE00000007	CDS	65774699	65774878	+
GWHAAZE00000007	CDS	65775547	65775660	+
GWHAAZE00000007	CDS	65776753	65776878	+

Transcript Sequence
>GWHTAAZE025708 ATGTCAACATCGGAGGAAGAAATCACGAGGCTATACAGAATTCGAATGACGGTGATGCAAATGCTGTTGGACAGAGGCTACGTGGTGACCAAACAGGAAGAAGAGATGACAAAAAGGGCTTTTATTTCGAAGTATGGTGAGAATATGAAAAGAGAGGACCTAGTTATCCAAAAAGCCAAGCGCAATGATGCCTCCGATCAGATTTATGTTTTCTTTCCTGAGGAACCGAAGGTTGGTGTAAAGACAATGAAGACTTATACCAATCGCATGAAATCAGAGAATGTTTTCCGAGCAATCTTGGTTGTCCAGCAAAATCTGACACCCTTTGCCCGTACATGTATAGCCGAGATATCTACAAAGTTCCATCTCGAGGTTTTCCAGGAGGCAGAGTTGTTGGTGAATGTTAAGGAACATACTCTAGTTCCTGAGCACCAGTTGCTTACAACTGAAGAAAAGAAGACCTTGCTGGACAGATACACTGTGAAAGAAACACAGTTACCTAGGATTCAGGTGACCGATCCAATTGCGAGATATTATGGGCTAAAGCGTGGGCAGGTGGTGAAGATTATAAGGCCGAGTGAGACCGCAGGACGTTACGTCACTTATCGATATGTTGTTTAA

Network for GWHGAAZE025674

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03871.15	RNA_pol_Rpb5_N	5	90	1.30E-30
PF01191.20	RNA_pol_Rpb5_C	133	205	3.10E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03013	RPB5, POLR2E	RNA polymerase	map03020
K03013	RPB5, POLR2E	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	46.639
	SRR3591706	second leaf	34.892
	SRR3591707	mature leaf	25.774
	SRR3591708	Shoot apex	55.719
	SRR3591709	Stem	42.853
	SRR3591710	White floral bud	53.252
	SRR3591711	White flower	65.971
	SRR3591712	Green floral bud	65.427
	SRR3591713	Yellow flower	64.327
SRP173429	SRR8316895	Juvenile bud stage	40.141
	SRR8316896	Juvenile bud stage	46.957
	SRR8316897	Juvenile bud stage	26.452
	SRR8316894	Third green stage	20.604
	SRR8316900	Third green stage	67.130
	SRR8316901	Third green stage	62.666
	SRR8316898	Complete white stage	35.094
	SRR8316899	Complete white stage	71.662
	SRR8316903	Complete white stage	43.835
	SRR8316902	Silver flowering stage	33.425
	SRR8316904	Silver flowering stage	43.787
	SRR8316905	Silver flowering stage	20.170
	SRR8316906	Gold flowering stage	51.175
	SRR8316907	Gold flowering stage	42.945
	SRR8316908	Gold flowering stage	64.224
SRP132670	SRR6706286	Control	34.483
	SRR6706287	Light intensity 50%	43.282
	SRR6706288	Light intensity 20%	49.514
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	44.677
	CNS0095593	Slightly white alabastrum(diploid) 2	50.008
	CNS0095594	Slightly white alabastrum(diploid) 3	41.727
	CNS0095595	Whole white alabastrum(diploid) 2	45.117
	CNS0095596	Whole white alabastrum(diploid) 3	46.267
	CNS0095597	Whole white alabastrum(diploid) 4	38.711
	CNS0095598	Silvery flower (diploied) 1	47.925
	CNS0095599	Silvery flower (diploied) 2	47.309
	CNS0095600	Silvery flower (diploied) 3	67.095
	CNS0095601	Golden flower (diploid) 1	44.210
	CNS0095602	Golden flower (diploid) 2	52.209
	CNS0095603	Golden flower (diploid) 3	52.417
	CNS0095604	Slightly white alabastrum(tetraploid) 1	56.714
	CNS0095605	Slightly white alabastrum(tetraploid) 2	46.741
	CNS0095606	Slightly white alabastrum(tetraploid) 3	81.539
	CNS0095607	Whole white alabastrum(tetraploid) 1	47.717
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.514
	CNS0095609	Whole white alabastrum(tetraploid) 3	67.297
	CNS0095610	Silvery flower (tetraploid) 1	80.161
	CNS0095611	Silvery flower (tetraploid) 2	94.155
	CNS0095612	Silvery flower (tetraploid) 3	67.734
	CNS0095613	Golden flower (tetraploid) 1	67.056
	CNS0095614	Golden flower (tetraploid) 2	82.878
	CNS0095615	Golden flower (tetraploid) 3	56.671
CRA001975	CRR073297	Stem 1	32.992
	CRR073298	Stem 2	31.662
	CRR073299	Stem 3	38.083
	CRR073300	Leaf 1	33.717
	CRR073301	Leaf 2	29.856
	CRR073302	Leaf 3	36.365
	CRR073303	Juvenile bud 1	38.836
	CRR073304	Juvenile bud 2	27.635
	CRR073305	Juvenile bud 3	33.300
	CRR073306	Third green 1	16.507
	CRR073307	Third green 2	17.696
	CRR073308	Third green 3	18.392
	CRR073309	Second white 1	22.670
	CRR073310	Second white 2	19.326
	CRR073311	Second white 3	14.506
	CRR073312	Silver flowering 1	19.887
	CRR073313	Silver flowering 2	21.108
	CRR073314	Silver flowering 3	19.355
	CRR073315	Gold flowering 1	17.942
	CRR073316	Gold flowering 2	17.992
	CRR073317	Gold flowering 3	12.592
	CRR073318	Tawny withering 1	30.535
	CRR073319	Tawny withering 2	32.821
	CRR073320	Tawny withering 3	37.044