Gene detail

Detail information of GWHGAAZE025673

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007013107.1	7.13972E-76	Phytochrome-associated protein 2 isoform 2 [Theobroma cacao]
Swissprot	tr\|Q38826\|IAA8_ARATH	2E-63	Auxin-responsive protein IAA8
trEMBL	tr\|A0A061GMJ1\|A0A061GMJ1_THECC	3E-76	Auxin-responsive protein {ECO:0000256\|RuleBase:RU004549}
TAIR10	AT2G22670.2	4E-52	indoleacetic acid-induced protein 8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65764108	65766186	+
GWHAAZE00000007	mRNA	65764108	65766186	+
GWHAAZE00000007	exon	65764108	65764111	+
GWHAAZE00000007	exon	65764512	65764745	+
GWHAAZE00000007	exon	65766041	65766186	+
GWHAAZE00000007	CDS	65764108	65764111	+
GWHAAZE00000007	CDS	65764512	65764745	+
GWHAAZE00000007	CDS	65766041	65766186	+

Transcript Sequence
>GWHTAAZE025707 ATGCATAGGGCACAAGTGGTGGGATGGCCACCAATCCGATCTTTCCGGAAAAATTCAATGGCAATCAATCCTCCCAAGAACGATGATGAAGCGGATGCAAAGATGGGTTCGAGTTGTTTATATGTCAAAGTCAGCATGGATGGTGCCCCTTACCTAAGGAAAGTTGATCTCAAGAACTACCCCAGCTATGTTGAACTATCTTCGGCTCTAGAAAAGATGTTCACCTGTTTTACAATTGGGCAATGCAGTTCTCATGGAGCTCCGATGCGAGACGGGCTGAGTGAGAGTCGACTAATGGACCTTCTTCACGGTTCTGAGTATGTACTTACCTACGAAGACAAAGATGGTGATTGGATGCTTGTTGGTGATGTACCTTGGGAGTAA

Network for GWHGAAZE025673

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02309.17	AUX_IAA	3	127	2.40E-65

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AUX/IAA

KEGG pathway

KO	Enzyme	pathway	mapID
K14484	IAA	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	270.160
	SRR3591706	second leaf	67.001
	SRR3591707	mature leaf	67.747
	SRR3591708	Shoot apex	205.244
	SRR3591709	Stem	395.674
	SRR3591710	White floral bud	69.831
	SRR3591711	White flower	42.706
	SRR3591712	Green floral bud	112.010
	SRR3591713	Yellow flower	9.382
SRP173429	SRR8316895	Juvenile bud stage	104.379
	SRR8316896	Juvenile bud stage	89.938
	SRR8316897	Juvenile bud stage	47.396
	SRR8316894	Third green stage	38.827
	SRR8316900	Third green stage	62.894
	SRR8316901	Third green stage	63.952
	SRR8316898	Complete white stage	11.669
	SRR8316899	Complete white stage	166.559
	SRR8316903	Complete white stage	33.687
	SRR8316902	Silver flowering stage	10.358
	SRR8316904	Silver flowering stage	9.909
	SRR8316905	Silver flowering stage	5.764
	SRR8316906	Gold flowering stage	19.763
	SRR8316907	Gold flowering stage	18.823
	SRR8316908	Gold flowering stage	20.430
SRP132670	SRR6706286	Control	52.516
	SRR6706287	Light intensity 50%	53.126
	SRR6706288	Light intensity 20%	53.667
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	113.866
	CNS0095593	Slightly white alabastrum(diploid) 2	168.349
	CNS0095594	Slightly white alabastrum(diploid) 3	99.909
	CNS0095595	Whole white alabastrum(diploid) 2	136.619
	CNS0095596	Whole white alabastrum(diploid) 3	49.086
	CNS0095597	Whole white alabastrum(diploid) 4	86.225
	CNS0095598	Silvery flower (diploied) 1	214.649
	CNS0095599	Silvery flower (diploied) 2	201.357
	CNS0095600	Silvery flower (diploied) 3	72.541
	CNS0095601	Golden flower (diploid) 1	228.463
	CNS0095602	Golden flower (diploid) 2	130.830
	CNS0095603	Golden flower (diploid) 3	119.795
	CNS0095604	Slightly white alabastrum(tetraploid) 1	92.346
	CNS0095605	Slightly white alabastrum(tetraploid) 2	84.199
	CNS0095606	Slightly white alabastrum(tetraploid) 3	204.256
	CNS0095607	Whole white alabastrum(tetraploid) 1	84.799
	CNS0095608	Whole white alabastrum(tetraploid) 2	47.507
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.970
	CNS0095610	Silvery flower (tetraploid) 1	26.653
	CNS0095611	Silvery flower (tetraploid) 2	63.326
	CNS0095612	Silvery flower (tetraploid) 3	28.593
	CNS0095613	Golden flower (tetraploid) 1	28.989
	CNS0095614	Golden flower (tetraploid) 2	45.930
	CNS0095615	Golden flower (tetraploid) 3	27.281
CRA001975	CRR073297	Stem 1	213.574
	CRR073298	Stem 2	214.845
	CRR073299	Stem 3	265.806
	CRR073300	Leaf 1	222.345
	CRR073301	Leaf 2	221.107
	CRR073302	Leaf 3	209.670
	CRR073303	Juvenile bud 1	188.392
	CRR073304	Juvenile bud 2	84.476
	CRR073305	Juvenile bud 3	261.673
	CRR073306	Third green 1	22.245
	CRR073307	Third green 2	30.327
	CRR073308	Third green 3	35.044
	CRR073309	Second white 1	23.853
	CRR073310	Second white 2	25.557
	CRR073311	Second white 3	12.052
	CRR073312	Silver flowering 1	5.113
	CRR073313	Silver flowering 2	7.797
	CRR073314	Silver flowering 3	9.554
	CRR073315	Gold flowering 1	112.298
	CRR073316	Gold flowering 2	120.712
	CRR073317	Gold flowering 3	120.994
	CRR073318	Tawny withering 1	731.405
	CRR073319	Tawny withering 2	693.849
	CRR073320	Tawny withering 3	996.117