Gene detail

Detail information of GWHGAAZE025646

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004251609.1	2.95126E-88	PREDICTED: chloroplast processing peptidase [Solanum lycopersicum]
COG	YP_007160577.1	3E-42	signal peptidase I
Swissprot	tr\|Q8H0W1\|PLSP1_ARATH	2E-81	Chloroplast processing peptidase (Precursor)
trEMBL	tr\|K4DBP9\|K4DBP9_SOLLC	1E-88	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc12g007120.1.1}
TAIR10	AT3G24590.1	7E-66	plastidic type i signal peptidase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65250892	65252693	+
GWHAAZE00000007	mRNA	65250892	65252693	+
GWHAAZE00000007	exon	65250892	65251038	+
GWHAAZE00000007	exon	65251774	65251860	+
GWHAAZE00000007	exon	65252166	65252233	+
GWHAAZE00000007	exon	65252543	65252693	+
GWHAAZE00000007	CDS	65250892	65251038	+
GWHAAZE00000007	CDS	65251774	65251860	+
GWHAAZE00000007	CDS	65252166	65252233	+
GWHAAZE00000007	CDS	65252543	65252693	+

Transcript Sequence
>GWHTAAZE025680 ATGTTTCAGGTTACGTACTATTTTAGAAAGCCATGCCCGAATGATATTGTGATATTTAAAAGCCCTCCAGTCCTGCAGGAAGTGGGATATACTGATGATGATGTGTTCATCAAACGAGTTGTTGCCAAGGAAGGTGACATTGTTGAGGTTCACGAAGGGAAGCTAATAGTAAACGGGGTCCCAAGAAGTGAGAAGTTCATTCTGGAAGCACCTAAATACGAAATGACACCAATTCGCGTGCCAGAGAACTCGGTTTTTGTGATGGGGGATAATCGTAACAACAGCTACGATTCACACGTATGGGGACCACTACCAACAAAAAATATAATAGGAAGATCAATATTTAAATATTGGCCTCCATCTAGGGCTGGTGGCACACTTCTTCCAGATGGTTGTGCTGTTGACAAGAAAGAAGAGAGTAGCAGCAGCATCACTAGTTTACCTGCTCAATAA

Network for GWHGAAZE025646

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	4	118	4.60E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03100	lepB	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0016021	cellular_component	integral component of membrane
GO:0016020	cellular_component	membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.605
	SRR3591706	second leaf	27.174
	SRR3591707	mature leaf	21.904
	SRR3591708	Shoot apex	44.450
	SRR3591709	Stem	14.709
	SRR3591710	White floral bud	35.525
	SRR3591711	White flower	50.084
	SRR3591712	Green floral bud	47.329
	SRR3591713	Yellow flower	54.339
SRP173429	SRR8316895	Juvenile bud stage	23.381
	SRR8316896	Juvenile bud stage	29.888
	SRR8316897	Juvenile bud stage	17.037
	SRR8316894	Third green stage	13.235
	SRR8316900	Third green stage	61.516
	SRR8316901	Third green stage	49.824
	SRR8316898	Complete white stage	23.873
	SRR8316899	Complete white stage	52.797
	SRR8316903	Complete white stage	26.775
	SRR8316902	Silver flowering stage	20.075
	SRR8316904	Silver flowering stage	26.733
	SRR8316905	Silver flowering stage	12.021
	SRR8316906	Gold flowering stage	57.920
	SRR8316907	Gold flowering stage	53.668
	SRR8316908	Gold flowering stage	53.367
SRP132670	SRR6706286	Control	31.320
	SRR6706287	Light intensity 50%	45.110
	SRR6706288	Light intensity 20%	52.297
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.614
	CNS0095593	Slightly white alabastrum(diploid) 2	25.846
	CNS0095594	Slightly white alabastrum(diploid) 3	13.429
	CNS0095595	Whole white alabastrum(diploid) 2	25.271
	CNS0095596	Whole white alabastrum(diploid) 3	31.362
	CNS0095597	Whole white alabastrum(diploid) 4	29.383
	CNS0095598	Silvery flower (diploied) 1	30.367
	CNS0095599	Silvery flower (diploied) 2	28.549
	CNS0095600	Silvery flower (diploied) 3	40.435
	CNS0095601	Golden flower (diploid) 1	27.339
	CNS0095602	Golden flower (diploid) 2	30.895
	CNS0095603	Golden flower (diploid) 3	32.060
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.195
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.437
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.173
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.327
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.990
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.475
	CNS0095610	Silvery flower (tetraploid) 1	41.125
	CNS0095611	Silvery flower (tetraploid) 2	42.398
	CNS0095612	Silvery flower (tetraploid) 3	37.727
	CNS0095613	Golden flower (tetraploid) 1	29.604
	CNS0095614	Golden flower (tetraploid) 2	37.036
	CNS0095615	Golden flower (tetraploid) 3	38.217
CRA001975	CRR073297	Stem 1	20.950
	CRR073298	Stem 2	23.169
	CRR073299	Stem 3	29.958
	CRR073300	Leaf 1	32.717
	CRR073301	Leaf 2	24.452
	CRR073302	Leaf 3	36.015
	CRR073303	Juvenile bud 1	32.312
	CRR073304	Juvenile bud 2	34.610
	CRR073305	Juvenile bud 3	28.206
	CRR073306	Third green 1	15.749
	CRR073307	Third green 2	10.546
	CRR073308	Third green 3	14.140
	CRR073309	Second white 1	29.335
	CRR073310	Second white 2	25.430
	CRR073311	Second white 3	22.913
	CRR073312	Silver flowering 1	24.138
	CRR073313	Silver flowering 2	15.311
	CRR073314	Silver flowering 3	19.670
	CRR073315	Gold flowering 1	34.387
	CRR073316	Gold flowering 2	44.580
	CRR073317	Gold flowering 3	41.038
	CRR073318	Tawny withering 1	8.602
	CRR073319	Tawny withering 2	14.681
	CRR073320	Tawny withering 3	12.930