Gene detail

Detail information of GWHGAAZE025643

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO48887.1	1.5643E-119	hypothetical protein CISIN_1g027783mg [Citrus sinensis]
Swissprot	tr\|Q9ZS51\|PMP22_ARATH	2E-16	Peroxisomal membrane protein PMP22
trEMBL	tr\|A0A067ECE3\|A0A067ECE3_CITSI	6E-120	Uncharacterized protein {ECO:0000313\|EMBL:KDO48887.1}
TAIR10	AT3G24570.1	1E-78	Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65237975	65240473	-
GWHAAZE00000007	mRNA	65237975	65240473	-
GWHAAZE00000007	exon	65240300	65240473	-
GWHAAZE00000007	exon	65238971	65239062	-
GWHAAZE00000007	exon	65237975	65238380	-
GWHAAZE00000007	CDS	65240300	65240473	-
GWHAAZE00000007	CDS	65238971	65239062	-
GWHAAZE00000007	CDS	65237975	65238380	-

Transcript Sequence
>GWHTAAZE025677 ATGATGAAGCTATGGAAATGGTACCAGAATTGCTTGGTTGTTCACCCAGTTAAGACCCAGGTCATCAGCTCTGGATTTCTGTGGGGTGTTGGTGACATTGCTGCTCAATCCATTAGTCACTCTACTGCCAAAAAACACCTTCATATTCGTGTGAGTACAGTACCCTTCTTGCCTCATGCAGATAGAGAGTTCAAAGTTGACTGGAAAAGAGTGGCAATTACAAGCATTTTTGGGTTTGGCTTTGTTGGACCAGTTGGCCAATTCTGGTATGAAGGTATGGACAGATTTATTAGGCATAGGCTTCAATTACAGCCAAATTCGGTCTGCTTTGTGGCAACTAAAGTGGCAATGGATGGCCTCATCATCGGGCCATTTGATTTGTTTATGTTCTTCACATACATGGGATTTTGCTCCGGTAAAAATGCAGTTCAAGTGAAGGAAGATTTGAAGAGAGATTTCCTCCCGGCCTTGATTCTCGAGGGTGGTATTTGGCCAATAGTTCAGGTTGCAAATTTTCGGTATGTTCCTGTAAGGTACCAGCTTTTGTATGTAAATTTGTTCTGCTTGTTGGATAGTGCTTTCTTGTCATGGATGGAGCAGCAAAAAGACACGCCATGGAAGCAGTGGTTCGCGTCAATTTCTTCTTTCAAATTTCCAGGTCACGGTAGATAA

Network for GWHGAAZE025643

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04117.13	Mpv17_PMP22	135	196	3.50E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13348	MPV17	Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.513
	SRR3591706	second leaf	13.759
	SRR3591707	mature leaf	6.198
	SRR3591708	Shoot apex	6.731
	SRR3591709	Stem	0.592
	SRR3591710	White floral bud	0.123
	SRR3591711	White flower	0.314
	SRR3591712	Green floral bud	0.309
	SRR3591713	Yellow flower	0.401
SRP173429	SRR8316895	Juvenile bud stage	1.685
	SRR8316896	Juvenile bud stage	0.927
	SRR8316897	Juvenile bud stage	1.639
	SRR8316894	Third green stage	0.781
	SRR8316900	Third green stage	1.721
	SRR8316901	Third green stage	2.279
	SRR8316898	Complete white stage	0.190
	SRR8316899	Complete white stage	0.809
	SRR8316903	Complete white stage	0.152
	SRR8316902	Silver flowering stage	0.280
	SRR8316904	Silver flowering stage	0.066
	SRR8316905	Silver flowering stage	0.078
	SRR8316906	Gold flowering stage	0.156
	SRR8316907	Gold flowering stage	0.075
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.528
	SRR6706287	Light intensity 50%	1.847
	SRR6706288	Light intensity 20%	1.547
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.059
	CNS0095593	Slightly white alabastrum(diploid) 2	0.481
	CNS0095594	Slightly white alabastrum(diploid) 3	1.673
	CNS0095595	Whole white alabastrum(diploid) 2	2.649
	CNS0095596	Whole white alabastrum(diploid) 3	3.732
	CNS0095597	Whole white alabastrum(diploid) 4	1.196
	CNS0095598	Silvery flower (diploied) 1	0.527
	CNS0095599	Silvery flower (diploied) 2	0.127
	CNS0095600	Silvery flower (diploied) 3	0.291
	CNS0095601	Golden flower (diploid) 1	0.303
	CNS0095602	Golden flower (diploid) 2	0.063
	CNS0095603	Golden flower (diploid) 3	0.080
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.768
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.268
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.394
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.507
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.598
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.779
	CNS0095610	Silvery flower (tetraploid) 1	1.690
	CNS0095611	Silvery flower (tetraploid) 2	2.028
	CNS0095612	Silvery flower (tetraploid) 3	0.035
	CNS0095613	Golden flower (tetraploid) 1	0.393
	CNS0095614	Golden flower (tetraploid) 2	1.248
	CNS0095615	Golden flower (tetraploid) 3	0.052
CRA001975	CRR073297	Stem 1	2.343
	CRR073298	Stem 2	2.255
	CRR073299	Stem 3	2.245
	CRR073300	Leaf 1	1.825
	CRR073301	Leaf 2	1.264
	CRR073302	Leaf 3	1.894
	CRR073303	Juvenile bud 1	0.515
	CRR073304	Juvenile bud 2	0.822
	CRR073305	Juvenile bud 3	0.433
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.178
	CRR073312	Silver flowering 1	0.141
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	7.872
	CRR073316	Gold flowering 2	9.220
	CRR073317	Gold flowering 3	7.274
	CRR073318	Tawny withering 1	1.736
	CRR073319	Tawny withering 2	0.801
	CRR073320	Tawny withering 3	0.000