Gene detail

Detail information of GWHGAAZE025459

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002512872.1	7.23499E-98	translocon-associated protein, beta subunit precursor, putative [Ricinus communis]
trEMBL	tr\|B9RH13\|B9RH13_RICCO	3E-98	Translocon-associated protein, beta subunit, putative {ECO:0000313\|EMBL:EEF49375.1}
TAIR10	AT5G14030.4	2E-53	translocon-associated protein beta (TRAPB) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	61503677	61507902	+
GWHAAZE00000007	mRNA	61503677	61507902	+
GWHAAZE00000007	exon	61503677	61503972	+
GWHAAZE00000007	exon	61506364	61506462	+
GWHAAZE00000007	exon	61506577	61506685	+
GWHAAZE00000007	exon	61506769	61506840	+
GWHAAZE00000007	exon	61507780	61507902	+
GWHAAZE00000007	five_prime_UTR	61503677	61503784	+
GWHAAZE00000007	CDS	61503785	61503972	+
GWHAAZE00000007	CDS	61506364	61506462	+
GWHAAZE00000007	CDS	61506577	61506685	+
GWHAAZE00000007	CDS	61506769	61506840	+
GWHAAZE00000007	CDS	61507780	61507902	+

Transcript Sequence
>GWHTAAZE025493 AGCCCTACCTGCCTGGTCTTCAGTCTAAACACATTCTCAAATACTACCTTCGATCCAATCAAATCTCATCCCCAAATCGACAACATTTTCCACAAGTTTGTATCGGAAATGGCGAATTTCATCGCCAATTCTCTCATCTCTGTACTGCTAATAGCTCTGTTCCTGTTGCCGGCATCTACGATCGCCAGTTCGGACTCTCCGTTCATCGTTGCGCACAAGAAGGCCACTCTCAACCGGCTCAAATCCGGCGTTGAACGAGTCTTCGTCACCATCGATATCTATAACGAAGGATCTGCGACGGCATATGATGTTAGTTTAACTGATGATAGCTGGTCCAAAGATATATTTGATGTCGTTTCTGGTAACACTTCAATGTCATGGGAAAGACTTGATGCTGGCTATCATCGATCACACGCCTTTGAACTGGAGTCTAAAGTACAAACAGTGTTTTATGGTGCACCAGCAGTTATCACTTTCCGCATCCCTACAAAAGCTTCTCTACAGGAATCCTATTCAACGGCGATTATGCCTCTTGAAATTCTGGCAGATAGGCCTCCTGAGAAGAAGTTTGAGTGGAGATTGTTGGCAAAATACGGGTCCCTAATTTCTGTGATCTCCATTGTGGTTTTGTTCATATACCTTGTTGCAAGTCCATCGTCGAAATCTAGTGCTACAAAGGGAAGCAAGAAGAAGCGCTAA

Network for GWHGAAZE025459

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05753.15	TRAP_beta	16	187	3.70E-52

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13250	SSR2	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	179.106
	SRR3591706	second leaf	99.008
	SRR3591707	mature leaf	43.248
	SRR3591708	Shoot apex	148.039
	SRR3591709	Stem	100.181
	SRR3591710	White floral bud	85.554
	SRR3591711	White flower	95.573
	SRR3591712	Green floral bud	138.010
	SRR3591713	Yellow flower	55.608
SRP173429	SRR8316895	Juvenile bud stage	85.626
	SRR8316896	Juvenile bud stage	134.148
	SRR8316897	Juvenile bud stage	73.373
	SRR8316894	Third green stage	52.738
	SRR8316900	Third green stage	150.055
	SRR8316901	Third green stage	140.159
	SRR8316898	Complete white stage	40.743
	SRR8316899	Complete white stage	100.041
	SRR8316903	Complete white stage	73.286
	SRR8316902	Silver flowering stage	44.206
	SRR8316904	Silver flowering stage	48.593
	SRR8316905	Silver flowering stage	21.297
	SRR8316906	Gold flowering stage	63.156
	SRR8316907	Gold flowering stage	69.825
	SRR8316908	Gold flowering stage	88.854
SRP132670	SRR6706286	Control	87.974
	SRR6706287	Light intensity 50%	83.521
	SRR6706288	Light intensity 20%	90.963
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	138.283
	CNS0095593	Slightly white alabastrum(diploid) 2	137.754
	CNS0095594	Slightly white alabastrum(diploid) 3	136.004
	CNS0095595	Whole white alabastrum(diploid) 2	121.907
	CNS0095596	Whole white alabastrum(diploid) 3	131.251
	CNS0095597	Whole white alabastrum(diploid) 4	99.533
	CNS0095598	Silvery flower (diploied) 1	67.295
	CNS0095599	Silvery flower (diploied) 2	71.774
	CNS0095600	Silvery flower (diploied) 3	81.278
	CNS0095601	Golden flower (diploid) 1	59.124
	CNS0095602	Golden flower (diploid) 2	71.907
	CNS0095603	Golden flower (diploid) 3	69.552
	CNS0095604	Slightly white alabastrum(tetraploid) 1	142.427
	CNS0095605	Slightly white alabastrum(tetraploid) 2	140.714
	CNS0095606	Slightly white alabastrum(tetraploid) 3	131.221
	CNS0095607	Whole white alabastrum(tetraploid) 1	110.100
	CNS0095608	Whole white alabastrum(tetraploid) 2	98.525
	CNS0095609	Whole white alabastrum(tetraploid) 3	113.822
	CNS0095610	Silvery flower (tetraploid) 1	65.572
	CNS0095611	Silvery flower (tetraploid) 2	60.582
	CNS0095612	Silvery flower (tetraploid) 3	70.912
	CNS0095613	Golden flower (tetraploid) 1	50.778
	CNS0095614	Golden flower (tetraploid) 2	68.350
	CNS0095615	Golden flower (tetraploid) 3	47.105
CRA001975	CRR073297	Stem 1	151.788
	CRR073298	Stem 2	127.250
	CRR073299	Stem 3	156.927
	CRR073300	Leaf 1	121.488
	CRR073301	Leaf 2	132.873
	CRR073302	Leaf 3	173.007
	CRR073303	Juvenile bud 1	165.971
	CRR073304	Juvenile bud 2	125.078
	CRR073305	Juvenile bud 3	139.016
	CRR073306	Third green 1	71.515
	CRR073307	Third green 2	79.613
	CRR073308	Third green 3	69.019
	CRR073309	Second white 1	110.008
	CRR073310	Second white 2	87.691
	CRR073311	Second white 3	67.686
	CRR073312	Silver flowering 1	97.101
	CRR073313	Silver flowering 2	129.612
	CRR073314	Silver flowering 3	95.756
	CRR073315	Gold flowering 1	75.390
	CRR073316	Gold flowering 2	80.168
	CRR073317	Gold flowering 3	80.666
	CRR073318	Tawny withering 1	196.174
	CRR073319	Tawny withering 2	194.411
	CRR073320	Tawny withering 3	189.841