Gene detail

Detail information of GWHGAAZE025453

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011045764.1	4.99925E-47	PREDICTED: NAC domain-containing protein 68 [Populus euphratica]
Swissprot	tr\|Q52QH4\|NAC68_ORYSJ	5E-26	NAC domain-containing protein 68
trEMBL	tr\|B9GF72\|B9GF72_POPTR	3E-47	Uncharacterized protein {ECO:0000313\|EMBL:EEE83457.2}
TAIR10	AT5G13180.1	3E-29	NAC domain containing protein 83

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	61390805	61391561	+
GWHAAZE00000007	mRNA	61390805	61391561	+
GWHAAZE00000007	exon	61390805	61390979	+
GWHAAZE00000007	exon	61391266	61391561	+
GWHAAZE00000007	CDS	61390805	61390979	+
GWHAAZE00000007	CDS	61391266	61391561	+

Transcript Sequence
>GWHTAAZE025487 ATGGATACGCCCATTTCTTCCTCTGGGTTGAAATTGCCCCTTGGATATAGATTTCATCCAACAGATGAAGAACTTCTTCTTCATTATTTGAAGAGAAAAGTTATGTCTCTTCCCTTGCCTGCCCCTGCTGTCTCTGATTTTGATGTTTTCGGAACACATCCTCTCCACTTACCAGGTGATTTAAAGGAGAAGAGGTATTTCTTTAGTCAAAGAAAAGGAAATGTGAAAAAATTCAGCGGTGGAATCATAATTACTTGTAATGATTTTGGGTATTGGAAGGCTATGGGAAAAGATGAGATTGTTATAATTCCCAGAACCAACCAAGCAATTGGGATAAAGAGATCTTTCGTTTTCTATGAAGGGAAATTAAAGACTCAATGGTTCATGGATCAGTATTGTCTTGTGGGTTCACCATTCACTCCAAATTCACTTCAGGTATTAGTTGTTCATATACTCATATCCATAATATAA

Network for GWHGAAZE025453

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	13	134	2.30E-24

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	64.980
	SRR3591706	second leaf	14.816
	SRR3591707	mature leaf	9.891
	SRR3591708	Shoot apex	18.919
	SRR3591709	Stem	50.689
	SRR3591710	White floral bud	35.497
	SRR3591711	White flower	43.151
	SRR3591712	Green floral bud	37.604
	SRR3591713	Yellow flower	43.746
SRP173429	SRR8316895	Juvenile bud stage	32.263
	SRR8316896	Juvenile bud stage	25.977
	SRR8316897	Juvenile bud stage	21.390
	SRR8316894	Third green stage	21.394
	SRR8316900	Third green stage	59.550
	SRR8316901	Third green stage	52.685
	SRR8316898	Complete white stage	16.406
	SRR8316899	Complete white stage	105.506
	SRR8316903	Complete white stage	34.706
	SRR8316902	Silver flowering stage	24.835
	SRR8316904	Silver flowering stage	31.463
	SRR8316905	Silver flowering stage	15.327
	SRR8316906	Gold flowering stage	57.862
	SRR8316907	Gold flowering stage	45.622
	SRR8316908	Gold flowering stage	53.919
SRP132670	SRR6706286	Control	4.787
	SRR6706287	Light intensity 50%	5.974
	SRR6706288	Light intensity 20%	6.904
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	61.367
	CNS0095593	Slightly white alabastrum(diploid) 2	85.680
	CNS0095594	Slightly white alabastrum(diploid) 3	66.920
	CNS0095595	Whole white alabastrum(diploid) 2	63.405
	CNS0095596	Whole white alabastrum(diploid) 3	33.375
	CNS0095597	Whole white alabastrum(diploid) 4	51.156
	CNS0095598	Silvery flower (diploied) 1	57.625
	CNS0095599	Silvery flower (diploied) 2	74.740
	CNS0095600	Silvery flower (diploied) 3	39.094
	CNS0095601	Golden flower (diploid) 1	64.963
	CNS0095602	Golden flower (diploid) 2	66.455
	CNS0095603	Golden flower (diploid) 3	66.999
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.095
	CNS0095605	Slightly white alabastrum(tetraploid) 2	29.609
	CNS0095606	Slightly white alabastrum(tetraploid) 3	50.236
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.682
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.311
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.460
	CNS0095610	Silvery flower (tetraploid) 1	19.572
	CNS0095611	Silvery flower (tetraploid) 2	16.997
	CNS0095612	Silvery flower (tetraploid) 3	18.342
	CNS0095613	Golden flower (tetraploid) 1	30.027
	CNS0095614	Golden flower (tetraploid) 2	17.646
	CNS0095615	Golden flower (tetraploid) 3	29.994
CRA001975	CRR073297	Stem 1	17.453
	CRR073298	Stem 2	18.461
	CRR073299	Stem 3	9.691
	CRR073300	Leaf 1	22.264
	CRR073301	Leaf 2	28.134
	CRR073302	Leaf 3	17.425
	CRR073303	Juvenile bud 1	19.842
	CRR073304	Juvenile bud 2	18.191
	CRR073305	Juvenile bud 3	21.268
	CRR073306	Third green 1	21.600
	CRR073307	Third green 2	14.209
	CRR073308	Third green 3	18.768
	CRR073309	Second white 1	19.903
	CRR073310	Second white 2	25.945
	CRR073311	Second white 3	19.712
	CRR073312	Silver flowering 1	33.685
	CRR073313	Silver flowering 2	30.477
	CRR073314	Silver flowering 3	28.716
	CRR073315	Gold flowering 1	6.591
	CRR073316	Gold flowering 2	8.258
	CRR073317	Gold flowering 3	9.331
	CRR073318	Tawny withering 1	29.076
	CRR073319	Tawny withering 2	124.141
	CRR073320	Tawny withering 3	37.155