Gene detail

Detail information of GWHGAAZE025378

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006447219.1	2.63716E-45	hypothetical protein CICLE_v10017121mg [Citrus clementina]
COG	YP_005887446.1	6E-17	heat shock protein Hsp20
Swissprot	tr\|P27880\|HSP12_MEDSA	6E-42	18.2 kDa class I heat shock protein
trEMBL	tr\|V4W3A2\|V4W3A2_9ROSI	1E-45	Uncharacterized protein {ECO:0000313\|EMBL:ESR60459.1}
TAIR10	AT1G53540.1	5E-20	HSP20-like chaperones superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60399026	60399487	+
GWHAAZE00000007	mRNA	60399026	60399487	+
GWHAAZE00000007	exon	60399026	60399487	+
GWHAAZE00000007	CDS	60399026	60399487	+

Transcript Sequence
>GWHTAAZE025412 ATGTCCTCAATGATCTCTACTATGTTTGGTGACACTGACCCTTTAATCCCTATACTGAATAAGTCTGCGTCGTTAACTTTTCCGGTCAACTGGAAGGAAACCCTGGAGGCCCACGTGTTCATCGCGGATTTGCCGGGCCTAAATAAAGAGGAGGTGAAGGTTGAATTAGAGGAAGGAAGAGTGTTGAAAATCAGTGGCAAGTGGAAAGTTGAAGAAGAGGAAAACGTTAAGTGGCACTGTGCAGAAAGGTGCCGGGGGGATTTTTGCCGGAGGTTTAGGCTGCCAGAAAATGCAAATGTGGAGGAAATTAAGGCCGGGATGGAGAACGGAGTGCTCACTATCACTGTTGCCAAACAGGGGATCAAGAAACGAGAGGTGAAAGTGATAGAGATTGAAGAAAAGAAGGTTGATCGGCTCCAAAAGTTTAAGAATAAGAATTGGTGTTGTTTTTGTTCCAAATAA

Network for GWHGAAZE025378

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	31	131	1.90E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.319
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.468
	SRR3591708	Shoot apex	0.165
	SRR3591709	Stem	1.784
	SRR3591710	White floral bud	0.187
	SRR3591711	White flower	0.720
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.460
SRP173429	SRR8316895	Juvenile bud stage	6.575
	SRR8316896	Juvenile bud stage	46.774
	SRR8316897	Juvenile bud stage	13.926
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.670
	SRR8316901	Third green stage	0.819
	SRR8316898	Complete white stage	0.104
	SRR8316899	Complete white stage	0.336
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.406
	SRR8316904	Silver flowering stage	0.359
	SRR8316905	Silver flowering stage	0.148
	SRR8316906	Gold flowering stage	4.090
	SRR8316907	Gold flowering stage	0.257
	SRR8316908	Gold flowering stage	0.683
SRP132670	SRR6706286	Control	1.052
	SRR6706287	Light intensity 50%	0.330
	SRR6706288	Light intensity 20%	0.632
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.569
	CNS0095593	Slightly white alabastrum(diploid) 2	0.304
	CNS0095594	Slightly white alabastrum(diploid) 3	1.363
	CNS0095595	Whole white alabastrum(diploid) 2	0.381
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.328
	CNS0095598	Silvery flower (diploied) 1	1.322
	CNS0095599	Silvery flower (diploied) 2	57.406
	CNS0095600	Silvery flower (diploied) 3	18.753
	CNS0095601	Golden flower (diploid) 1	211.981
	CNS0095602	Golden flower (diploid) 2	29.068
	CNS0095603	Golden flower (diploid) 3	34.971
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.415
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.647
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.511
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.518
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.597
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.320
	CNS0095610	Silvery flower (tetraploid) 1	0.929
	CNS0095611	Silvery flower (tetraploid) 2	1.609
	CNS0095612	Silvery flower (tetraploid) 3	0.667
	CNS0095613	Golden flower (tetraploid) 1	1.336
	CNS0095614	Golden flower (tetraploid) 2	1.277
	CNS0095615	Golden flower (tetraploid) 3	1.207
CRA001975	CRR073297	Stem 1	0.886
	CRR073298	Stem 2	0.171
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.069
	CRR073301	Leaf 2	1.373
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.144
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.134
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.241
	CRR073320	Tawny withering 3	0.102