Gene detail

Detail information of GWHGAAZE025262

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP40526.1	8.59313E-73	hypothetical protein JCGZ_24525 [Jatropha curcas]
COG	YP_720574.1	3E-13	adenylate/guanylate cyclase
Swissprot	tr\|O80366\|ARR9_ARATH	1E-63	Two-component response regulator ARR9
trEMBL	tr\|A0A067KWD7\|A0A067KWD7_JATCU	3E-73	Uncharacterized protein {ECO:0000313\|EMBL:KDP40526.1}
TAIR10	AT3G57040.1	1E-51	response regulator 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	58404913	58406438	+
GWHAAZE00000007	mRNA	58404913	58406438	+
GWHAAZE00000007	exon	58404913	58405021	+
GWHAAZE00000007	exon	58405337	58405446	+
GWHAAZE00000007	exon	58405600	58405677	+
GWHAAZE00000007	exon	58405913	58405983	+
GWHAAZE00000007	exon	58406241	58406295	+
GWHAAZE00000007	exon	58406388	58406438	+
GWHAAZE00000007	CDS	58404913	58405021	+
GWHAAZE00000007	CDS	58405337	58405446	+
GWHAAZE00000007	CDS	58405600	58405677	+
GWHAAZE00000007	CDS	58405913	58405983	+
GWHAAZE00000007	CDS	58406241	58406295	+
GWHAAZE00000007	CDS	58406388	58406438	+

Transcript Sequence
>GWHTAAZE025296 ATGGGGGCTGTTGCCACTGATGATGCAAAATTTCATGTGTTAGCAGTTGATGATAGTATCATTGACAGAAAACTAATTGAGAGGCTCCTAAAAACCTCTTCTTATCAAGTTACTGCAGTGGATTCTGTACGAAAGGCTTTGGAATTTCTTGGCTTGCAACATAATGAAGAGATGGATTCAGAGTTTCCCACTGCTTCTTCTTCAGGCCATTATCATCATGAAATGGAAGTAAATTTGATTATTACAGATTATTGTATGCCTGGGATGACTGGCTATGATCTACTAAGGAAGATCAAGGAATCAACATCTCTGAAAGACATACCAGTTATAATAATGTCCTCTGAGAATGTTCCTTCAAGAATTAATAGATGCTTGGAAGAAGGGGCAGAGGAGTTCTTCTTGAAGCCAGTCCAATTATCAGATGAGAGCAAGAACAAGATACAATCAAGAATTGCAATGTCCAATGAAGAATAA

Network for GWHGAAZE025262

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0192	Transcription factor Others family Transcription factor Others GO:0000160 phosphorelay signal transduction system GOslim:biological_process map00906 Carotenoid biosynthesis map04075 Plant hormone signal transduction

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00072.25	Response_reg	13	140	3.10E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.233
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.512
	SRR3591708	Shoot apex	0.129
	SRR3591709	Stem	3.749
	SRR3591710	White floral bud	7.617
	SRR3591711	White flower	11.621
	SRR3591712	Green floral bud	2.128
	SRR3591713	Yellow flower	17.376
SRP173429	SRR8316895	Juvenile bud stage	0.024
	SRR8316896	Juvenile bud stage	0.544
	SRR8316897	Juvenile bud stage	0.114
	SRR8316894	Third green stage	0.408
	SRR8316900	Third green stage	2.048
	SRR8316901	Third green stage	3.406
	SRR8316898	Complete white stage	1.351
	SRR8316899	Complete white stage	2.093
	SRR8316903	Complete white stage	2.641
	SRR8316902	Silver flowering stage	2.270
	SRR8316904	Silver flowering stage	1.176
	SRR8316905	Silver flowering stage	0.693
	SRR8316906	Gold flowering stage	7.566
	SRR8316907	Gold flowering stage	4.743
	SRR8316908	Gold flowering stage	26.836
SRP132670	SRR6706286	Control	0.163
	SRR6706287	Light intensity 50%	0.217
	SRR6706288	Light intensity 20%	0.131
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.788
	CNS0095593	Slightly white alabastrum(diploid) 2	1.326
	CNS0095594	Slightly white alabastrum(diploid) 3	3.690
	CNS0095595	Whole white alabastrum(diploid) 2	1.738
	CNS0095596	Whole white alabastrum(diploid) 3	3.338
	CNS0095597	Whole white alabastrum(diploid) 4	1.090
	CNS0095598	Silvery flower (diploied) 1	1.337
	CNS0095599	Silvery flower (diploied) 2	2.660
	CNS0095600	Silvery flower (diploied) 3	1.310
	CNS0095601	Golden flower (diploid) 1	1.013
	CNS0095602	Golden flower (diploid) 2	2.428
	CNS0095603	Golden flower (diploid) 3	1.731
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.183
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.384
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.275
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.999
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.620
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.465
	CNS0095610	Silvery flower (tetraploid) 1	2.418
	CNS0095611	Silvery flower (tetraploid) 2	1.478
	CNS0095612	Silvery flower (tetraploid) 3	1.188
	CNS0095613	Golden flower (tetraploid) 1	2.773
	CNS0095614	Golden flower (tetraploid) 2	4.055
	CNS0095615	Golden flower (tetraploid) 3	0.973
CRA001975	CRR073297	Stem 1	0.099
	CRR073298	Stem 2	0.272
	CRR073299	Stem 3	0.030
	CRR073300	Leaf 1	0.317
	CRR073301	Leaf 2	1.058
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.091
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.147
	CRR073306	Third green 1	0.035
	CRR073307	Third green 2	0.135
	CRR073308	Third green 3	0.256
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.164
	CRR073311	Second white 3	0.294
	CRR073312	Silver flowering 1	2.167
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	1.936
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.816
	CRR073319	Tawny withering 2	2.333
	CRR073320	Tawny withering 3	0.276