Gene detail

Detail information of GWHGAAZE025110

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010661448.1	1.62884E-50	PREDICTED: DNA replication ATP-dependent helicase/nuclease DNA2 isoform X4 [Vitis vinifera]
trEMBL	tr\|F6GVH0\|F6GVH0_VITVI	7E-42	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43953.1}
TAIR10	AT1G08840.2	3E-14	DNA replication helicase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	55331412	55333042	+
GWHAAZE00000007	mRNA	55331412	55333042	+
GWHAAZE00000007	exon	55331412	55331441	+
GWHAAZE00000007	exon	55331859	55332095	+
GWHAAZE00000007	exon	55332180	55332242	+
GWHAAZE00000007	exon	55332821	55333042	+
GWHAAZE00000007	CDS	55331412	55331441	+
GWHAAZE00000007	CDS	55331859	55332095	+
GWHAAZE00000007	CDS	55332180	55332242	+
GWHAAZE00000007	CDS	55332821	55333042	+

Transcript Sequence
>GWHTAAZE025144 ATGAATTTTCACCATTGCTCACACAATAAGACTTCGATTGGCTCAGTGGGGAAGCTTGAAAAGTGGCTTTCTTCGCCTCCAATGAGTGCTGCTGAAAAATCTTTGATATTCTCAAATAAGATTGGTTTGAAAGGGGTTAGACTAGATCATGAAATGGATTTACTTGGAAGTGATGAAAATGCAAATGAAAATAATAATGATTCTGGCTTGCTTAATAGCCAGAGCCCTTTTAAGACTCCACCATCTCTTTCATATTGTAATGACAAGCCCGCAGATGGTGTTGATCCTAATGGAGTATCTGATCAGCTGGGTTCCAGACAACACAAAAAGGCGCTGCTTGACCTTTTGGATCAAGTAGAAGATGTAATTTCTGTTGAAGAACCAATTCGTAAGGACCCAAAGGCCTTCTTATCTAGAACTCAAGGTAGAATTGATGATGAGAGATCCATCAAATGTGATCCTACTGTGACAGCACTGGCAATCGGTTCAACTGAGAATGTCAATAGAGAACCTCCCAATATCTATTTTCTTGTATTGGAGGTATGCTTCAGC

Network for GWHGAAZE025110

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10742	DNA2	DNA replication	map03030

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.206
	SRR3591706	second leaf	0.566
	SRR3591707	mature leaf	0.176
	SRR3591708	Shoot apex	3.675
	SRR3591709	Stem	0.099
	SRR3591710	White floral bud	0.250
	SRR3591711	White flower	0.271
	SRR3591712	Green floral bud	0.341
	SRR3591713	Yellow flower	0.333
SRP173429	SRR8316895	Juvenile bud stage	1.265
	SRR8316896	Juvenile bud stage	1.547
	SRR8316897	Juvenile bud stage	0.634
	SRR8316894	Third green stage	0.811
	SRR8316900	Third green stage	0.580
	SRR8316901	Third green stage	0.988
	SRR8316898	Complete white stage	0.313
	SRR8316899	Complete white stage	0.280
	SRR8316903	Complete white stage	0.339
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.528
	SRR8316905	Silver flowering stage	0.285
	SRR8316906	Gold flowering stage	0.449
	SRR8316907	Gold flowering stage	0.222
	SRR8316908	Gold flowering stage	0.290
SRP132670	SRR6706286	Control	0.812
	SRR6706287	Light intensity 50%	1.367
	SRR6706288	Light intensity 20%	0.924
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.698
	CNS0095593	Slightly white alabastrum(diploid) 2	0.412
	CNS0095594	Slightly white alabastrum(diploid) 3	0.390
	CNS0095595	Whole white alabastrum(diploid) 2	0.553
	CNS0095596	Whole white alabastrum(diploid) 3	0.887
	CNS0095597	Whole white alabastrum(diploid) 4	0.190
	CNS0095598	Silvery flower (diploied) 1	0.381
	CNS0095599	Silvery flower (diploied) 2	1.209
	CNS0095600	Silvery flower (diploied) 3	0.165
	CNS0095601	Golden flower (diploid) 1	0.347
	CNS0095602	Golden flower (diploid) 2	0.368
	CNS0095603	Golden flower (diploid) 3	0.385
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.991
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.417
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.749
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.590
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.109
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.350
	CNS0095610	Silvery flower (tetraploid) 1	0.136
	CNS0095611	Silvery flower (tetraploid) 2	0.236
	CNS0095612	Silvery flower (tetraploid) 3	0.468
	CNS0095613	Golden flower (tetraploid) 1	0.281
	CNS0095614	Golden flower (tetraploid) 2	0.126
	CNS0095615	Golden flower (tetraploid) 3	0.201
CRA001975	CRR073297	Stem 1	2.210
	CRR073298	Stem 2	1.057
	CRR073299	Stem 3	0.662
	CRR073300	Leaf 1	1.106
	CRR073301	Leaf 2	0.462
	CRR073302	Leaf 3	0.784
	CRR073303	Juvenile bud 1	0.562
	CRR073304	Juvenile bud 2	0.301
	CRR073305	Juvenile bud 3	1.097
	CRR073306	Third green 1	0.145
	CRR073307	Third green 2	0.261
	CRR073308	Third green 3	0.069
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.541
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.641
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.998