Gene detail

Detail information of GWHGAAZE025082

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009413273.1	3.2143E-70	PREDICTED: nucleoside diphosphate kinase 1-like [Musa acuminata subsp. malaccensis]
COG	YP_007062040.1	1E-56	nucleoside diphosphate kinase
Swissprot	tr\|Q56E62\|NDK1_TOBAC	2E-69	Nucleoside diphosphate kinase 1
trEMBL	tr\|M0TQK4\|M0TQK4_MUSAM	1E-70	Nucleoside diphosphate kinase {ECO:0000256\|RuleBase:RU004013}
TAIR10	AT4G09320.1	3E-50	Nucleoside diphosphate kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	54873470	54875265	-
GWHAAZE00000007	mRNA	54873470	54875265	-
GWHAAZE00000007	exon	54873470	54873584	-
GWHAAZE00000007	exon	54874066	54874297	-
GWHAAZE00000007	exon	54875160	54875265	-
GWHAAZE00000007	CDS	54875160	54875265	-
GWHAAZE00000007	CDS	54874066	54874297	-
GWHAAZE00000007	CDS	54873470	54873584	-

Transcript Sequence
>GWHTAAZE025116 ATGTATGACCTTTTGGCAGTCAGCAGAGAAAATGAAGGGAATTTTTCTCTGTTTCAGGTTGGTGAAGTAATTGGCAGATTTGAGAAGAAGGGTTTCTATTTGAAAGGGTTGAAGCTTGTGAACGTGGAGCGTTCTTTAGCCGAGCAGCACTATGGGGAGCACGCCTCCAAACCCTTCTTCCCCGCATTAGTTGAGTACATTATCTCTGGCCCGGTTGTTGCAATGGTTTGGGAAGGAGTGGGTGTAATTGCCACGTGTCGAAAGCTTATTGGTGCAACAAATCCCTTGGACTCCGCTCCTGGTACCATCCGCGGTGATTTTGCAATTGCCATGAAAAGGAATATAATTCATGGGAGCGATTCGGTGGAGAGTGCGAAGAAAGAGATGGCTCTGTGGTTCCCCGAAGGGATTACACAATGGCAGAGCAACCTTCACAATTGGATTAATGAGTGA

Network for GWHGAAZE025082

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00334.20	NDK	20	135	1.00E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00940	ndk, NME	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983
		MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006165	biological_process	nucleoside diphosphate phosphorylation
GO:0006183	biological_process	GTP biosynthetic process
GO:0006228	biological_process	UTP biosynthetic process
GO:0006241	biological_process	CTP biosynthetic process
GO:0004550	molecular_function	nucleoside diphosphate kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	21.747
	SRR3591706	second leaf	30.976
	SRR3591707	mature leaf	142.434
	SRR3591708	Shoot apex	3.491
	SRR3591709	Stem	45.674
	SRR3591710	White floral bud	154.349
	SRR3591711	White flower	563.584
	SRR3591712	Green floral bud	81.678
	SRR3591713	Yellow flower	807.876
SRP173429	SRR8316895	Juvenile bud stage	17.774
	SRR8316896	Juvenile bud stage	52.718
	SRR8316897	Juvenile bud stage	16.071
	SRR8316894	Third green stage	12.444
	SRR8316900	Third green stage	57.648
	SRR8316901	Third green stage	76.857
	SRR8316898	Complete white stage	49.121
	SRR8316899	Complete white stage	4.637
	SRR8316903	Complete white stage	63.404
	SRR8316902	Silver flowering stage	251.220
	SRR8316904	Silver flowering stage	304.912
	SRR8316905	Silver flowering stage	173.395
	SRR8316906	Gold flowering stage	544.955
	SRR8316907	Gold flowering stage	568.410
	SRR8316908	Gold flowering stage	594.602
SRP132670	SRR6706286	Control	27.172
	SRR6706287	Light intensity 50%	29.392
	SRR6706288	Light intensity 20%	23.160
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.383
	CNS0095593	Slightly white alabastrum(diploid) 2	40.504
	CNS0095594	Slightly white alabastrum(diploid) 3	61.732
	CNS0095595	Whole white alabastrum(diploid) 2	68.635
	CNS0095596	Whole white alabastrum(diploid) 3	81.379
	CNS0095597	Whole white alabastrum(diploid) 4	68.368
	CNS0095598	Silvery flower (diploied) 1	200.581
	CNS0095599	Silvery flower (diploied) 2	163.321
	CNS0095600	Silvery flower (diploied) 3	392.412
	CNS0095601	Golden flower (diploid) 1	239.001
	CNS0095602	Golden flower (diploid) 2	427.546
	CNS0095603	Golden flower (diploid) 3	411.915
	CNS0095604	Slightly white alabastrum(tetraploid) 1	87.942
	CNS0095605	Slightly white alabastrum(tetraploid) 2	88.331
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.584
	CNS0095607	Whole white alabastrum(tetraploid) 1	122.906
	CNS0095608	Whole white alabastrum(tetraploid) 2	139.331
	CNS0095609	Whole white alabastrum(tetraploid) 3	101.204
	CNS0095610	Silvery flower (tetraploid) 1	374.118
	CNS0095611	Silvery flower (tetraploid) 2	270.382
	CNS0095612	Silvery flower (tetraploid) 3	242.357
	CNS0095613	Golden flower (tetraploid) 1	577.205
	CNS0095614	Golden flower (tetraploid) 2	487.554
	CNS0095615	Golden flower (tetraploid) 3	391.930
CRA001975	CRR073297	Stem 1	13.297
	CRR073298	Stem 2	12.263
	CRR073299	Stem 3	9.327
	CRR073300	Leaf 1	34.042
	CRR073301	Leaf 2	27.257
	CRR073302	Leaf 3	14.659
	CRR073303	Juvenile bud 1	30.189
	CRR073304	Juvenile bud 2	40.312
	CRR073305	Juvenile bud 3	1.548
	CRR073306	Third green 1	203.255
	CRR073307	Third green 2	175.444
	CRR073308	Third green 3	174.615
	CRR073309	Second white 1	474.716
	CRR073310	Second white 2	459.792
	CRR073311	Second white 3	370.006
	CRR073312	Silver flowering 1	525.674
	CRR073313	Silver flowering 2	499.489
	CRR073314	Silver flowering 3	554.922
	CRR073315	Gold flowering 1	50.224
	CRR073316	Gold flowering 2	44.554
	CRR073317	Gold flowering 3	37.868
	CRR073318	Tawny withering 1	10.302
	CRR073319	Tawny withering 2	15.588
	CRR073320	Tawny withering 3	5.706