Gene detail

Detail information of GWHGAAZE025080

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010919751.1	3.5194E-90	PREDICTED: protein mago nashi homolog [Elaeis guineensis]
Swissprot	tr\|P49030\|MGN_ORYSJ	2E-85	Protein mago nashi homolog
trEMBL	tr\|A0A022PZ51\|A0A022PZ51_ERYGU	2E-88	Uncharacterized protein {ECO:0000313\|EMBL:EYU20168.1}
TAIR10	AT1G02140.1	9E-65	mago nashi family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	54847914	54849547	+
GWHAAZE00000007	mRNA	54847914	54849547	+
GWHAAZE00000007	exon	54847914	54848135	+
GWHAAZE00000007	exon	54849341	54849547	+
GWHAAZE00000007	CDS	54847914	54848135	+
GWHAAZE00000007	CDS	54849341	54849547	+

Transcript Sequence
>GWHTAAZE025114 ATGGCGGCATCATCTGGGGAAGAAGAGGAGTTCTATTTGAGGTACTACGTGGGTCACAAGGGCAAATTTGGGCATGAATTCTTGGAGTTTGAGTTCCGACCCGACGGCAAGCTCCGTTACGCCAACAACTCCAATTACAAGAACGACACTATGATCCGCAAAGAGGTCTTCCTCACCCCTTCTGTTCTTCGCGAATGTCGTCGCATCATATCTGATAGCGAGATCATGAAGGAAGATGATAATAATTGGCCAGAACCTGACCGTGTTGGGCGGCAAGAGCTTGAAATAGTGATGGGAAATGAGCATATCTCCTTCACTACTTCAAAGATTGGGTCGCTTATGGATGTCCAGACCAGTAAGGATCCGGAAGGGCTTCGTATTTTCTATTATCTTGTTCAGGTTAGTTGCATCACTAGTAAACATGTATAA

Network for GWHGAAZE025080

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02792.15	Mago_nashi	11	133	2.30E-66

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12877	MAGOH	Spliceosome	map03040
		RNA transport	map03013
		mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0008380	biological_process	RNA splicing
GO:0005634	cellular_component	nucleus
GO:0035145	cellular_component	exon-exon junction complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	80.647
	SRR3591706	second leaf	26.028
	SRR3591707	mature leaf	16.975
	SRR3591708	Shoot apex	89.538
	SRR3591709	Stem	66.459
	SRR3591710	White floral bud	46.105
	SRR3591711	White flower	47.709
	SRR3591712	Green floral bud	59.944
	SRR3591713	Yellow flower	42.634
SRP173429	SRR8316895	Juvenile bud stage	38.550
	SRR8316896	Juvenile bud stage	66.354
	SRR8316897	Juvenile bud stage	34.998
	SRR8316894	Third green stage	19.827
	SRR8316900	Third green stage	65.989
	SRR8316901	Third green stage	63.085
	SRR8316898	Complete white stage	20.853
	SRR8316899	Complete white stage	58.810
	SRR8316903	Complete white stage	29.062
	SRR8316902	Silver flowering stage	20.667
	SRR8316904	Silver flowering stage	23.329
	SRR8316905	Silver flowering stage	10.048
	SRR8316906	Gold flowering stage	38.489
	SRR8316907	Gold flowering stage	44.058
	SRR8316908	Gold flowering stage	45.829
SRP132670	SRR6706286	Control	54.574
	SRR6706287	Light intensity 50%	51.678
	SRR6706288	Light intensity 20%	60.170
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	79.608
	CNS0095593	Slightly white alabastrum(diploid) 2	74.663
	CNS0095594	Slightly white alabastrum(diploid) 3	75.155
	CNS0095595	Whole white alabastrum(diploid) 2	78.049
	CNS0095596	Whole white alabastrum(diploid) 3	90.489
	CNS0095597	Whole white alabastrum(diploid) 4	76.097
	CNS0095598	Silvery flower (diploied) 1	45.895
	CNS0095599	Silvery flower (diploied) 2	69.013
	CNS0095600	Silvery flower (diploied) 3	53.552
	CNS0095601	Golden flower (diploid) 1	86.023
	CNS0095602	Golden flower (diploid) 2	57.461
	CNS0095603	Golden flower (diploid) 3	59.264
	CNS0095604	Slightly white alabastrum(tetraploid) 1	86.409
	CNS0095605	Slightly white alabastrum(tetraploid) 2	78.778
	CNS0095606	Slightly white alabastrum(tetraploid) 3	77.262
	CNS0095607	Whole white alabastrum(tetraploid) 1	80.735
	CNS0095608	Whole white alabastrum(tetraploid) 2	86.541
	CNS0095609	Whole white alabastrum(tetraploid) 3	75.166
	CNS0095610	Silvery flower (tetraploid) 1	52.704
	CNS0095611	Silvery flower (tetraploid) 2	59.278
	CNS0095612	Silvery flower (tetraploid) 3	53.438
	CNS0095613	Golden flower (tetraploid) 1	59.181
	CNS0095614	Golden flower (tetraploid) 2	58.457
	CNS0095615	Golden flower (tetraploid) 3	78.549
CRA001975	CRR073297	Stem 1	35.742
	CRR073298	Stem 2	39.367
	CRR073299	Stem 3	48.509
	CRR073300	Leaf 1	35.444
	CRR073301	Leaf 2	37.362
	CRR073302	Leaf 3	42.393
	CRR073303	Juvenile bud 1	44.034
	CRR073304	Juvenile bud 2	37.871
	CRR073305	Juvenile bud 3	33.327
	CRR073306	Third green 1	31.260
	CRR073307	Third green 2	28.454
	CRR073308	Third green 3	26.272
	CRR073309	Second white 1	22.409
	CRR073310	Second white 2	15.161
	CRR073311	Second white 3	13.447
	CRR073312	Silver flowering 1	16.295
	CRR073313	Silver flowering 2	26.972
	CRR073314	Silver flowering 3	27.855
	CRR073315	Gold flowering 1	21.757
	CRR073316	Gold flowering 2	16.641
	CRR073317	Gold flowering 3	19.114
	CRR073318	Tawny withering 1	48.467
	CRR073319	Tawny withering 2	36.270
	CRR073320	Tawny withering 3	48.396