Gene detail

Detail information of GWHGAAZE025066

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009593488.1	2.0962E-59	PREDICTED: ethylene-responsive transcription factor 13-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q40479\|ERF2_TOBAC	4E-46	Ethylene-responsive transcription factor 2
trEMBL	tr\|K4AYX2\|K4AYX2_SOLLC	5E-58	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g090310.2.1}
TAIR10	AT2G44840.1	1E-30	ethylene-responsive element binding factor 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	54544359	54544949	+
GWHAAZE00000007	mRNA	54544359	54544949	+
GWHAAZE00000007	exon	54544359	54544949	+
GWHAAZE00000007	CDS	54544359	54544949	+

Transcript Sequence
>GWHTAAZE025100 ATGTACGGACAAAGCATATCAGAATCCGACCTAGCCCTTCTAGATTCCATTCAACACCATCTTCTCAATGACACTGCTGACTTTTCCGATATTTTTCCGGCTATAAACTCGCCGGACTATGGCCAGAGTTTTAGCCCAGCCGATCTCAATTCTCCTGACAATCTTATGGATCCGTTCGAAATTTCCGGCTCCACATCCCAGACTGAAGTGAAGGTGGAATTTGAGGAAACTGAGAGTCCTGCGCCACTGGTGGTAGAGGGGCGTGAAACTCGCGCGCAGATTCTGGAGGCGCGTGGGGGACACGCTCCAGCAGAGTGGAGGAGGTACAGAGGGGTGAGGAGGCGGCCGTGGGGGAAGTTCGCGGCGGAGATAAGGGACCCGGCGAAGATGGGCGCACGGGTGTGGCTCGGTACTTACGAGACTTCTGAGGACGCTGCTCTGGCTTACGACCAAGCTGCGTACAAGATACGCGGCTCGCGCGCGTTGCTTAACTTCCCGCACTTGATCGGTTTGAATGTGGCGGAGCCTGTTAGGGTTACGCCTCGGCGCCGGTCACCAGATCCCTTGTCGGAAAACGGGTTTAGGAAGTGA

Network for GWHGAAZE025066

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	108	158	2.90E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.224
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.845
	SRR3591711	White flower	0.126
	SRR3591712	Green floral bud	0.214
	SRR3591713	Yellow flower	2.737
SRP173429	SRR8316895	Juvenile bud stage	0.902
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.736
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.152
	SRR8316898	Complete white stage	0.073
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.067
	SRR8316902	Silver flowering stage	0.047
	SRR8316904	Silver flowering stage	0.234
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	3.434
	SRR8316907	Gold flowering stage	1.894
	SRR8316908	Gold flowering stage	8.429
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.267
	SRR6706288	Light intensity 20%	0.044
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.303
	CNS0095593	Slightly white alabastrum(diploid) 2	0.443
	CNS0095594	Slightly white alabastrum(diploid) 3	1.190
	CNS0095595	Whole white alabastrum(diploid) 2	0.063
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.267
	CNS0095598	Silvery flower (diploied) 1	0.645
	CNS0095599	Silvery flower (diploied) 2	0.300
	CNS0095600	Silvery flower (diploied) 3	0.487
	CNS0095601	Golden flower (diploid) 1	3.214
	CNS0095602	Golden flower (diploid) 2	0.752
	CNS0095603	Golden flower (diploid) 3	1.042
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.103
	CNS0095613	Golden flower (tetraploid) 1	1.727
	CNS0095614	Golden flower (tetraploid) 2	1.406
	CNS0095615	Golden flower (tetraploid) 3	0.315
CRA001975	CRR073297	Stem 1	0.125
	CRR073298	Stem 2	0.268
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.153
	CRR073311	Second white 3	0.530
	CRR073312	Silver flowering 1	5.399
	CRR073313	Silver flowering 2	2.892
	CRR073314	Silver flowering 3	2.817
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.114
	CRR073319	Tawny withering 2	0.533
	CRR073320	Tawny withering 3	0.000