Gene detail

Detail information of GWHGAAZE025045

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011093328.1	6.00702E-71	PREDICTED: ethylene-responsive transcription factor ERF039 [Sesamum indicum]
Swissprot	tr\|Q8LBQ7\|ERF34_ARATH	4E-63	Ethylene-responsive transcription factor ERF034
trEMBL	tr\|M1CGG5\|M1CGG5_SOLTU	1E-68	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400066977}
TAIR10	AT2G44940.1	4E-36	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	54123179	54123709	-
GWHAAZE00000007	mRNA	54123179	54123709	-
GWHAAZE00000007	exon	54123424	54123709	-
GWHAAZE00000007	exon	54123179	54123390	-
GWHAAZE00000007	CDS	54123424	54123709	-
GWHAAZE00000007	CDS	54123179	54123390	-

Transcript Sequence
>GWHTAAZE025079 ATGTATAGGGGGGTACGGTTGAGAAATTGGGGCAAATGGGTGTCTGAAATTCGAGAGCCACGAAAGAAATCAAGAATATGGCTCGGTACATTCCCCACGGCTGAAATGGCAGCTCGAGCTCATGACGTAGCGGCTCTAGCCATCAAAGGCCACTCGGCTTACCTAAACTTCCCTCACTTGGCTCATGAACTTCCTAGGCCAGCCACCAACTCCCCCAAAGACATCCAAGCGGCTGCAGCCAAGGCTGCAGCTGCTTTGCTTGGAGCCGAATCTGAGCCAAGCCAAGTATCATCATCATCATCGTCATCAAATAACACGAAAGTTGAACCGTTGGATTCTCCTTCGACGAATGATGATGATACATTTTTTGACTTACCAGATCTTTCCCTAGACTTGCCGGATCGAAGTGATGGATATTGTTACTATGCTTCTTCATGGCAGCTCGCTGGAGCCGATAGTGGATTTCGGCTAGAGGAGCCATTTTTAATGGAGTATTAA

Network for GWHGAAZE025045

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	2	51	2.70E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.704
	SRR3591706	second leaf	12.015
	SRR3591707	mature leaf	14.723
	SRR3591708	Shoot apex	5.753
	SRR3591709	Stem	2.870
	SRR3591710	White floral bud	1.062
	SRR3591711	White flower	1.457
	SRR3591712	Green floral bud	4.713
	SRR3591713	Yellow flower	0.561
SRP173429	SRR8316895	Juvenile bud stage	0.541
	SRR8316896	Juvenile bud stage	0.088
	SRR8316897	Juvenile bud stage	0.132
	SRR8316894	Third green stage	0.800
	SRR8316900	Third green stage	0.825
	SRR8316901	Third green stage	0.655
	SRR8316898	Complete white stage	0.220
	SRR8316899	Complete white stage	0.903
	SRR8316903	Complete white stage	0.192
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.919
	SRR6706287	Light intensity 50%	1.025
	SRR6706288	Light intensity 20%	1.214
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.921
	CNS0095593	Slightly white alabastrum(diploid) 2	1.536
	CNS0095594	Slightly white alabastrum(diploid) 3	0.878
	CNS0095595	Whole white alabastrum(diploid) 2	0.733
	CNS0095596	Whole white alabastrum(diploid) 3	1.173
	CNS0095597	Whole white alabastrum(diploid) 4	0.944
	CNS0095598	Silvery flower (diploied) 1	0.457
	CNS0095599	Silvery flower (diploied) 2	0.319
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.365
	CNS0095602	Golden flower (diploid) 2	0.301
	CNS0095603	Golden flower (diploid) 3	0.315
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.582
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.532
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.487
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.714
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.828
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.989
	CNS0095610	Silvery flower (tetraploid) 1	0.261
	CNS0095611	Silvery flower (tetraploid) 2	1.009
	CNS0095612	Silvery flower (tetraploid) 3	0.357
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.110
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.397
	CRR073298	Stem 2	1.345
	CRR073299	Stem 3	1.822
	CRR073300	Leaf 1	0.415
	CRR073301	Leaf 2	0.296
	CRR073302	Leaf 3	0.031
	CRR073303	Juvenile bud 1	0.244
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.182
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.098
	CRR073316	Gold flowering 2	0.116
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	4.015
	CRR073319	Tawny withering 2	8.154
	CRR073320	Tawny withering 3	3.576