Gene detail

Detail information of GWHGAAZE025006

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19940.1	7.48263E-45	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q0JBF0\|YAB5_ORYSJ	5E-36	Protein YABBY 5
trEMBL	tr\|A0A068VGH3\|A0A068VGH3_COFCA	3E-45	Coffea canephora DH200=94 genomic scaffold, scaffold_796 {ECO:0000313\|EMBL:CDP19940.1}
TAIR10	AT2G45190.1	2E-29	Plant-specific transcription factor YABBY family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	53348089	53350509	+
GWHAAZE00000007	mRNA	53348089	53350509	+
GWHAAZE00000007	exon	53348089	53348179	+
GWHAAZE00000007	exon	53349709	53349757	+
GWHAAZE00000007	exon	53350115	53350190	+
GWHAAZE00000007	exon	53350306	53350509	+
GWHAAZE00000007	CDS	53348089	53348179	+
GWHAAZE00000007	CDS	53349709	53349757	+
GWHAAZE00000007	CDS	53350115	53350190	+
GWHAAZE00000007	CDS	53350306	53350509	+

Transcript Sequence
>GWHTAAZE025040 ATGTTCATCAATCAACTGCCAAACCCGAGTGAGCCTATCATGCAGGTTCCTGGATTTGTTGATCTTCCTAAACCTCCCACAGCTAATAAAACTACAGAGAAGAGACAGAGAGTGCCTTCTGCTTACAATCGCTTCATCAAGGAAGAGATCCAACGCATCAAGGCTGAAAATCCAGACATAAATCACAGGGAGGCTTTTAGTGCTGCTGCAAAGAATTGGGCCCACTTCCCTCACATTCAATTTGGAATTATGCCTGATCAGCCCGTGAAGAAAAATCTTGTGTGCCAACAGGTACTCTTCAACCCAATGAGGTTAATTACCCTTTCTCTCCTTAGTGTTATTGTCAAATTAAAAAATTGGCATCGACACATTTGTAAAAATACGGGTCCGTTTGTAAAATTAAAGTCAAAACATGATTAA

Network for GWHGAAZE025006

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04690.14	YABBY	25	82	7.00E-36

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-YABBY

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0007275	biological_process	multicellular organism development

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.244
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	6.667
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.278
	SRR3591711	White flower	0.414
	SRR3591712	Green floral bud	6.541
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.776
	SRR8316896	Juvenile bud stage	2.923
	SRR8316897	Juvenile bud stage	1.028
	SRR8316894	Third green stage	1.347
	SRR8316900	Third green stage	2.491
	SRR8316901	Third green stage	2.805
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	2.166
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.117
	SRR8316904	Silver flowering stage	0.079
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.056
SRP132670	SRR6706286	Control	4.046
	SRR6706287	Light intensity 50%	5.527
	SRR6706288	Light intensity 20%	6.321
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.097
	CNS0095593	Slightly white alabastrum(diploid) 2	1.249
	CNS0095594	Slightly white alabastrum(diploid) 3	3.037
	CNS0095595	Whole white alabastrum(diploid) 2	1.618
	CNS0095596	Whole white alabastrum(diploid) 3	0.372
	CNS0095597	Whole white alabastrum(diploid) 4	1.028
	CNS0095598	Silvery flower (diploied) 1	0.956
	CNS0095599	Silvery flower (diploied) 2	1.770
	CNS0095600	Silvery flower (diploied) 3	0.347
	CNS0095601	Golden flower (diploid) 1	0.444
	CNS0095602	Golden flower (diploid) 2	1.104
	CNS0095603	Golden flower (diploid) 3	0.392
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.745
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.164
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.023
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.277
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.052
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.435
	CNS0095610	Silvery flower (tetraploid) 1	0.067
	CNS0095611	Silvery flower (tetraploid) 2	0.572
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.319
	CNS0095614	Golden flower (tetraploid) 2	0.306
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.971
	CRR073298	Stem 2	4.345
	CRR073299	Stem 3	0.381
	CRR073300	Leaf 1	1.900
	CRR073301	Leaf 2	6.014
	CRR073302	Leaf 3	3.653
	CRR073303	Juvenile bud 1	1.642
	CRR073304	Juvenile bud 2	0.376
	CRR073305	Juvenile bud 3	0.151
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.088
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.029
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000