Gene detail

Detail information of GWHGAAZE024983

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009596116.1	2.70706E-43	PREDICTED: 40S ribosomal protein S13-like [Nicotiana tomentosiformis]
COG	YP_003816538.1	2E-19	30S ribosomal protein S15P/S13e
Swissprot	tr\|P59224\|RS132_ARATH	2E-45	40S ribosomal protein S13-2
trEMBL	tr\|R0FHC6\|R0FHC6_9BRAS	1E-43	Uncharacterized protein {ECO:0000313\|EMBL:EOA21747.1}
TAIR10	AT4G00100.1	2E-36	ribosomal protein S13A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	53033915	53036369	+
GWHAAZE00000007	mRNA	53033915	53036369	+
GWHAAZE00000007	exon	53033915	53034008	+
GWHAAZE00000007	exon	53035297	53035483	+
GWHAAZE00000007	exon	53036336	53036369	+
GWHAAZE00000007	CDS	53033915	53034008	+
GWHAAZE00000007	CDS	53035297	53035483	+
GWHAAZE00000007	CDS	53036336	53036369	+

Transcript Sequence
>GWHTAAZE025017 ATGTGTTCAGTAATCACTCATCATTGCCTTTCATCTCAAATCTTTCAATCTGAACTGGATGGGTTAAGGAATTATGAATCAAATGTTTTACCAAGGCTTGCTCCAGAAATACCCGAGGATCTTTACCACCTCATTAAGAAAGCCGTGGCCATTAGGAAGCATCTAGAAAGGAACAGAAAGGATAAGGATTCTAAATTCAGGTTGATTCTTGTTGAGAGCAGAATTCACCGACTTGCTCGTTACTACAAGAAGACAAAGAAGCTTCCACCAGTTTGGAAATACGAATCAACCACAGCCAGCACTCTTGTGGCCTAA

Network for GWHGAAZE024983

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00312.23	Ribosomal_S15	36	99	9.30E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02953	RP-S13e, RPS13	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	36.245
	SRR3591706	second leaf	12.514
	SRR3591707	mature leaf	11.972
	SRR3591708	Shoot apex	54.860
	SRR3591709	Stem	20.359
	SRR3591710	White floral bud	14.145
	SRR3591711	White flower	21.229
	SRR3591712	Green floral bud	23.750
	SRR3591713	Yellow flower	15.002
SRP173429	SRR8316895	Juvenile bud stage	11.540
	SRR8316896	Juvenile bud stage	17.561
	SRR8316897	Juvenile bud stage	7.316
	SRR8316894	Third green stage	5.750
	SRR8316900	Third green stage	24.788
	SRR8316901	Third green stage	18.883
	SRR8316898	Complete white stage	5.754
	SRR8316899	Complete white stage	24.656
	SRR8316903	Complete white stage	8.762
	SRR8316902	Silver flowering stage	8.461
	SRR8316904	Silver flowering stage	5.774
	SRR8316905	Silver flowering stage	4.201
	SRR8316906	Gold flowering stage	8.550
	SRR8316907	Gold flowering stage	8.121
	SRR8316908	Gold flowering stage	7.463
SRP132670	SRR6706286	Control	4.052
	SRR6706287	Light intensity 50%	6.634
	SRR6706288	Light intensity 20%	3.658
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.065
	CNS0095593	Slightly white alabastrum(diploid) 2	19.437
	CNS0095594	Slightly white alabastrum(diploid) 3	21.765
	CNS0095595	Whole white alabastrum(diploid) 2	15.509
	CNS0095596	Whole white alabastrum(diploid) 3	21.049
	CNS0095597	Whole white alabastrum(diploid) 4	12.995
	CNS0095598	Silvery flower (diploied) 1	9.335
	CNS0095599	Silvery flower (diploied) 2	9.864
	CNS0095600	Silvery flower (diploied) 3	7.207
	CNS0095601	Golden flower (diploid) 1	6.709
	CNS0095602	Golden flower (diploid) 2	7.342
	CNS0095603	Golden flower (diploid) 3	7.413
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.045
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.938
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.468
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.746
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.161
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.511
	CNS0095610	Silvery flower (tetraploid) 1	8.204
	CNS0095611	Silvery flower (tetraploid) 2	4.993
	CNS0095612	Silvery flower (tetraploid) 3	1.737
	CNS0095613	Golden flower (tetraploid) 1	5.517
	CNS0095614	Golden flower (tetraploid) 2	6.022
	CNS0095615	Golden flower (tetraploid) 3	5.390
CRA001975	CRR073297	Stem 1	7.620
	CRR073298	Stem 2	5.318
	CRR073299	Stem 3	9.426
	CRR073300	Leaf 1	3.437
	CRR073301	Leaf 2	5.943
	CRR073302	Leaf 3	8.151
	CRR073303	Juvenile bud 1	4.224
	CRR073304	Juvenile bud 2	3.525
	CRR073305	Juvenile bud 3	6.094
	CRR073306	Third green 1	2.004
	CRR073307	Third green 2	2.119
	CRR073308	Third green 3	1.256
	CRR073309	Second white 1	1.528
	CRR073310	Second white 2	2.172
	CRR073311	Second white 3	1.100
	CRR073312	Silver flowering 1	1.833
	CRR073313	Silver flowering 2	1.440
	CRR073314	Silver flowering 3	0.233
	CRR073315	Gold flowering 1	5.136
	CRR073316	Gold flowering 2	5.220
	CRR073317	Gold flowering 3	3.427
	CRR073318	Tawny withering 1	12.164
	CRR073319	Tawny withering 2	6.729
	CRR073320	Tawny withering 3	6.502