Gene detail

Detail information of GWHGAAZE024957

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO85884.1	2.84698E-62	hypothetical protein CISIN_1g010681mg [Citrus sinensis]
COG	YP_001022570.1	0.0000001	cytochrome
Swissprot	tr\|Q50EK3\|C04C1_PINTA	1E-38	Cytochrome P450 704C1
trEMBL	tr\|A0A067H1Z7\|A0A067H1Z7_CITSI	1E-62	Uncharacterized protein {ECO:0000313\|EMBL:KDO85884.1}
TAIR10	AT2G45510.1	4E-31	cytochrome P450, family 704, subfamily A, polypeptide 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	52615552	52616294	-
GWHAAZE00000007	mRNA	52615552	52616294	-
GWHAAZE00000007	exon	52615552	52615692	-
GWHAAZE00000007	exon	52615789	52616004	-
GWHAAZE00000007	exon	52616286	52616294	-
GWHAAZE00000007	CDS	52616286	52616294	-
GWHAAZE00000007	CDS	52615789	52616004	-
GWHAAZE00000007	CDS	52615552	52615692	-

Transcript Sequence
>GWHTAAZE024991 ATGGAAATTGGAGATTATAATTACAGTATTTTAAGAGATCTATTAGGTGATGGGATCTTCACAGTTGATGGTGACAAGTGGCGTGAACAGAGAAAGGTTTCAAGCTACGAATTCTCAACAAAAGTATTGAGGGGCTTTAGTAGCGTAATCTTCAGGAAAAATGTGGTAAAACTTGCTAATATACTGTCCGAAGCAGCAACTTCCAACAAGATAATTGATATCCAAGACATGTTCATGAAATCAACCTTGGATTCGATATTCAAAGTTGCTTTTGGAATTGAACTTGACAGCATGTGTGGTTCAAGTGAAGAAGGCACAAAATTTAGCAATGCATTTGATGATGCGAGTGCAATGATACTCAAGTGA

Network for GWHGAAZE024957

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	13	104	3.20E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0004497	molecular_function	monooxygenase activity
GO:0005506	molecular_function	iron ion binding
GO:0020037	molecular_function	heme binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.663
	SRR3591706	second leaf	28.725
	SRR3591707	mature leaf	6.576
	SRR3591708	Shoot apex	13.681
	SRR3591709	Stem	5.387
	SRR3591710	White floral bud	14.072
	SRR3591711	White flower	4.970
	SRR3591712	Green floral bud	21.600
	SRR3591713	Yellow flower	7.363
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.103
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.032
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.011
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.202
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.017
	CNS0095610	Silvery flower (tetraploid) 1	0.174
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000