Gene detail

Detail information of GWHGAAZE024912

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006341718.1	5.64786E-57	PREDICTED: pollen-specific protein SF3-like [Solanum tuberosum]
Swissprot	tr\|O80839\|PLI2A_ARATH	4E-55	LIM domain-containing protein PLIM2a {ECO:0000305}
trEMBL	tr\|M1ANE4\|M1ANE4_SOLTU	2E-57	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400026590}
TAIR10	AT2G45800.1	6E-45	GATA type zinc finger transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	51648973	51650313	+
GWHAAZE00000007	mRNA	51648973	51650313	+
GWHAAZE00000007	exon	51648973	51649107	+
GWHAAZE00000007	exon	51649391	51649490	+
GWHAAZE00000007	exon	51649585	51649688	+
GWHAAZE00000007	exon	51650209	51650313	+
GWHAAZE00000007	CDS	51648973	51649107	+
GWHAAZE00000007	CDS	51649391	51649490	+
GWHAAZE00000007	CDS	51649585	51649688	+
GWHAAZE00000007	CDS	51650209	51650313	+

Transcript Sequence
>GWHTAAZE024946 ATGGCATTCACAGGAACTTTGGATAAATGCAAGGCTTGTGACAAGACTGTTTATTTTGTTGATTTGTTGACTGCTGATGGAATTATTTATCATAGAAACTGCTTCAAATGTACCCATTGCAAAGGGTTACTTGTGATGAGCAACTACTCCTCCCTGGACGGAATCCTCTACTGCAAGCCACATTTTGAACAACTTTTCAAAGAATCAGGAAACTTTAGCAAGAATTTCATAACATCACCAAAAGGAAATTTAAAGCCTCCAAGCAAGCTTTGCTCCTTCTTCTCAGGGACCATAGACAAATGTTCTACTTGTAGCAAAAAAGTTTATCCATTGGACAAGGCACCATTTTGCACAACTCTTCATGGAGAAAGGGAATTTCACTCATGTCCTTCAAGCAGCCACTCTAAGAAGAATTGCAATGGAACAGCCTGTTTCGCCGGTTAA

Network for GWHGAAZE024912

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00412.23	LIM	10	65	2.00E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.332
	SRR3591706	second leaf	0.650
	SRR3591707	mature leaf	0.949
	SRR3591708	Shoot apex	1.590
	SRR3591709	Stem	6.278
	SRR3591710	White floral bud	1005.619
	SRR3591711	White flower	53.842
	SRR3591712	Green floral bud	1128.866
	SRR3591713	Yellow flower	36.999
SRP173429	SRR8316895	Juvenile bud stage	80.761
	SRR8316896	Juvenile bud stage	344.110
	SRR8316897	Juvenile bud stage	179.350
	SRR8316894	Third green stage	159.115
	SRR8316900	Third green stage	603.807
	SRR8316901	Third green stage	589.812
	SRR8316898	Complete white stage	0.266
	SRR8316899	Complete white stage	4.607
	SRR8316903	Complete white stage	1.721
	SRR8316902	Silver flowering stage	11.058
	SRR8316904	Silver flowering stage	22.480
	SRR8316905	Silver flowering stage	5.486
	SRR8316906	Gold flowering stage	4.017
	SRR8316907	Gold flowering stage	0.665
	SRR8316908	Gold flowering stage	1.321
SRP132670	SRR6706286	Control	75.646
	SRR6706287	Light intensity 50%	84.409
	SRR6706288	Light intensity 20%	84.770
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	696.051
	CNS0095593	Slightly white alabastrum(diploid) 2	524.748
	CNS0095594	Slightly white alabastrum(diploid) 3	839.081
	CNS0095595	Whole white alabastrum(diploid) 2	1326.785
	CNS0095596	Whole white alabastrum(diploid) 3	1514.166
	CNS0095597	Whole white alabastrum(diploid) 4	1844.372
	CNS0095598	Silvery flower (diploied) 1	39.632
	CNS0095599	Silvery flower (diploied) 2	154.937
	CNS0095600	Silvery flower (diploied) 3	32.889
	CNS0095601	Golden flower (diploid) 1	54.646
	CNS0095602	Golden flower (diploid) 2	27.713
	CNS0095603	Golden flower (diploid) 3	26.844
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1281.476
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1467.117
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.688
	CNS0095607	Whole white alabastrum(tetraploid) 1	2181.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	2359.871
	CNS0095609	Whole white alabastrum(tetraploid) 3	967.202
	CNS0095610	Silvery flower (tetraploid) 1	18.204
	CNS0095611	Silvery flower (tetraploid) 2	102.871
	CNS0095612	Silvery flower (tetraploid) 3	236.312
	CNS0095613	Golden flower (tetraploid) 1	50.218
	CNS0095614	Golden flower (tetraploid) 2	7.374
	CNS0095615	Golden flower (tetraploid) 3	154.287
CRA001975	CRR073297	Stem 1	65.314
	CRR073298	Stem 2	75.691
	CRR073299	Stem 3	32.015
	CRR073300	Leaf 1	208.878
	CRR073301	Leaf 2	125.316
	CRR073302	Leaf 3	79.676
	CRR073303	Juvenile bud 1	132.835
	CRR073304	Juvenile bud 2	95.421
	CRR073305	Juvenile bud 3	10.456
	CRR073306	Third green 1	42.466
	CRR073307	Third green 2	58.379
	CRR073308	Third green 3	55.815
	CRR073309	Second white 1	1.367
	CRR073310	Second white 2	22.879
	CRR073311	Second white 3	16.132
	CRR073312	Silver flowering 1	76.965
	CRR073313	Silver flowering 2	63.907
	CRR073314	Silver flowering 3	40.918
	CRR073315	Gold flowering 1	70.331
	CRR073316	Gold flowering 2	36.291
	CRR073317	Gold flowering 3	11.394
	CRR073318	Tawny withering 1	97.125
	CRR073319	Tawny withering 2	115.588
	CRR073320	Tawny withering 3	91.197