Gene detail

Detail information of GWHGAAZE024899

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010269705.1	3.1042E-103	PREDICTED: RNA-binding protein 8A-B [Nelumbo nucifera]
COG	YP_007082390.1	1E-10	RRM domain-containing RNA-binding protein
Swissprot	tr\|Q93W34\|RP45C_ARATH	4E-10	Polyadenylate-binding protein RBP45C
trEMBL	tr\|A0A067JH32\|A0A067JH32_JATCU	3E-102	Uncharacterized protein {ECO:0000313\|EMBL:KDP22118.1}
TAIR10	AT1G51510.1	5E-64	RNA-binding (RRM/RBD/RNP motifs) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	51466289	51470301	+
GWHAAZE00000007	mRNA	51466289	51470301	+
GWHAAZE00000007	exon	51466289	51466568	+
GWHAAZE00000007	exon	51467909	51468045	+
GWHAAZE00000007	exon	51470152	51470301	+
GWHAAZE00000007	CDS	51466289	51466568	+
GWHAAZE00000007	CDS	51467909	51468045	+
GWHAAZE00000007	CDS	51470152	51470301	+

Transcript Sequence
>GWHTAAZE024933 ATGGCGAACGCAGATGTGGAAGCGGTGGATTTCGAGCCGGAAGATGACGATCTCATGGACGAAGACGGTGCAGTCGACGTTGATGCATCTTCTTCACCTAGTAGGGCTCATATTCCAAAGCTCAAGTCGGCCATCACCGGTGGTGGTAGTTCCTCATTAGCCAACCCTAAGAAAACCAAAGGCCGTGGATTCCGTGAAGAGACCGATGCCGAGCGTAACAATCGTATGTCTGGTCGCTTCGATTCTCTTGATTCTGAAGGCGGGCCTGGACCTGAACGATCCATTGAAGGATGGATTATTCTTGTGACTGGAATTCATGAAGAGGCACAAGAGGATGACCTTCAAAATGCATTTGGCGACTTTGGGGAGATGAAGAATCTGCATCTTAATCTTGATCGTCGAACTGGATTTGTCAAGGGGTATGCACTGATTGAATTTGAGAACTATGCAGAGGCAGAGAAGGCAATATCAGTAATGGATGGAGCTGAATTGCTCACCCAAATCATAAGTGTTGATTGGGCGTTTAGCAAAGGTCCCTTCAAAAGGAGGAATACAAGGAGGAGGTAA

Network for GWHGAAZE024899

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	100	165	3.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12876	RBM8A, Y14	Spliceosome	map03040
		RNA transport	map03013
		mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0006396	biological_process	RNA processing
GO:0005634	cellular_component	nucleus
GO:0005737	cellular_component	cytoplasm
GO:0003723	molecular_function	RNA binding
GO:0003729	molecular_function	mRNA binding
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	83.323
	SRR3591706	second leaf	55.240
	SRR3591707	mature leaf	42.873
	SRR3591708	Shoot apex	117.007
	SRR3591709	Stem	68.106
	SRR3591710	White floral bud	66.974
	SRR3591711	White flower	65.021
	SRR3591712	Green floral bud	65.991
	SRR3591713	Yellow flower	51.953
SRP173429	SRR8316895	Juvenile bud stage	47.466
	SRR8316896	Juvenile bud stage	61.625
	SRR8316897	Juvenile bud stage	32.748
	SRR8316894	Third green stage	26.082
	SRR8316900	Third green stage	66.889
	SRR8316901	Third green stage	72.147
	SRR8316898	Complete white stage	34.878
	SRR8316899	Complete white stage	114.279
	SRR8316903	Complete white stage	44.057
	SRR8316902	Silver flowering stage	29.502
	SRR8316904	Silver flowering stage	31.694
	SRR8316905	Silver flowering stage	16.714
	SRR8316906	Gold flowering stage	45.782
	SRR8316907	Gold flowering stage	48.888
	SRR8316908	Gold flowering stage	46.656
SRP132670	SRR6706286	Control	69.089
	SRR6706287	Light intensity 50%	69.616
	SRR6706288	Light intensity 20%	74.423
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	57.735
	CNS0095593	Slightly white alabastrum(diploid) 2	66.369
	CNS0095594	Slightly white alabastrum(diploid) 3	50.765
	CNS0095595	Whole white alabastrum(diploid) 2	50.467
	CNS0095596	Whole white alabastrum(diploid) 3	47.880
	CNS0095597	Whole white alabastrum(diploid) 4	39.223
	CNS0095598	Silvery flower (diploied) 1	60.627
	CNS0095599	Silvery flower (diploied) 2	50.368
	CNS0095600	Silvery flower (diploied) 3	48.631
	CNS0095601	Golden flower (diploid) 1	51.567
	CNS0095602	Golden flower (diploid) 2	55.797
	CNS0095603	Golden flower (diploid) 3	57.766
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.127
	CNS0095605	Slightly white alabastrum(tetraploid) 2	43.935
	CNS0095606	Slightly white alabastrum(tetraploid) 3	86.563
	CNS0095607	Whole white alabastrum(tetraploid) 1	32.817
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.793
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.137
	CNS0095610	Silvery flower (tetraploid) 1	44.352
	CNS0095611	Silvery flower (tetraploid) 2	41.863
	CNS0095612	Silvery flower (tetraploid) 3	35.744
	CNS0095613	Golden flower (tetraploid) 1	25.885
	CNS0095614	Golden flower (tetraploid) 2	41.419
	CNS0095615	Golden flower (tetraploid) 3	33.353
CRA001975	CRR073297	Stem 1	71.633
	CRR073298	Stem 2	78.692
	CRR073299	Stem 3	99.615
	CRR073300	Leaf 1	79.737
	CRR073301	Leaf 2	83.838
	CRR073302	Leaf 3	101.680
	CRR073303	Juvenile bud 1	84.469
	CRR073304	Juvenile bud 2	69.551
	CRR073305	Juvenile bud 3	58.946
	CRR073306	Third green 1	34.294
	CRR073307	Third green 2	39.893
	CRR073308	Third green 3	33.308
	CRR073309	Second white 1	31.528
	CRR073310	Second white 2	30.371
	CRR073311	Second white 3	24.221
	CRR073312	Silver flowering 1	22.645
	CRR073313	Silver flowering 2	23.536
	CRR073314	Silver flowering 3	27.622
	CRR073315	Gold flowering 1	51.498
	CRR073316	Gold flowering 2	62.167
	CRR073317	Gold flowering 3	46.827
	CRR073318	Tawny withering 1	95.845
	CRR073319	Tawny withering 2	99.372
	CRR073320	Tawny withering 3	113.017