Gene detail

Detail information of GWHGAAZE024840

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009779476.1	6.27615E-59	PREDICTED: uncharacterized protein LOC104228664 [Nicotiana sylvestris]
trEMBL	tr\|K4CWH1\|K4CWH1_SOLLC	2E-58	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc09g091450.2.1}
TAIR10	AT1G09815.1	6E-33	polymerase delta 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	50415742	50417287	-
GWHAAZE00000007	mRNA	50415742	50417287	-
GWHAAZE00000007	exon	50415742	50416021	-
GWHAAZE00000007	exon	50416984	50417287	-
GWHAAZE00000007	five_prime_UTR	50417165	50417287	-
GWHAAZE00000007	CDS	50416984	50417164	-
GWHAAZE00000007	CDS	50415828	50416021	-
GWHAAZE00000007	three_prime_UTR	50415742	50415827	-

Transcript Sequence
>GWHTAAZE024874 ACAAATAAAGTCGTACGAACATCTGTATCTGAAAACAACGAATTCAAATTTCAAAATTTGAAAAAACCTAATAACCCAAATCAAGAAGAAGAAGAAGTGTAGTAACTCGAGGAACAATCAACAATGGCGGCACGAGGGGACATGAAGGGTTTCTATAAGCAGAAGAAGAAAAGTGGGGCCATTACCAAGCCCTCCTCTAAGTCTAAATCTTCTTCATCCTCGAAAAAATCATCATCAGCAACTTTAGGCACCGCTATCCCCCAACCTTCCGCTCTCATCTCCCATGGCTTTCTCGATCTCAAAGATGATTATGATGCAAATGAGGAGGTGTTGAGGCAATTCGACATGAACATGGCATACGGACCTTGTATTGGGATGAGTAGATTGGCTCGTTGGGAGCGTGCTAGTTCTCTTGGTATGAATCCTCCAAACGATGTGGAGCGCCTCCTGAGATCGGCCAAGGTTCGATCTGAATCCCTGTGGGATGGCCATGTTTAGATATGTTATATAACTTGTATGTTTGATCATGGTTTTCTGGTCTTATCAGTAGATGAACTGGGGTGTTTTTCAGCCTCTGGCTGTAA

Network for GWHGAAZE024840

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04081.14	DNA_pol_delta_4	60	113	2.90E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03505	POLD4	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420
		Mismatch repair	map03430
		Homologous recombination	map03440

Gene Ontology

GO term	Ontology	Name
GO:0006260	biological_process	DNA replication
GO:0005634	cellular_component	nucleus

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.593
	SRR3591706	second leaf	26.909
	SRR3591707	mature leaf	20.517
	SRR3591708	Shoot apex	108.577
	SRR3591709	Stem	39.494
	SRR3591710	White floral bud	21.387
	SRR3591711	White flower	29.489
	SRR3591712	Green floral bud	42.595
	SRR3591713	Yellow flower	20.050
SRP173429	SRR8316895	Juvenile bud stage	26.114
	SRR8316896	Juvenile bud stage	34.323
	SRR8316897	Juvenile bud stage	16.355
	SRR8316894	Third green stage	10.728
	SRR8316900	Third green stage	36.069
	SRR8316901	Third green stage	32.760
	SRR8316898	Complete white stage	11.106
	SRR8316899	Complete white stage	37.877
	SRR8316903	Complete white stage	15.091
	SRR8316902	Silver flowering stage	7.001
	SRR8316904	Silver flowering stage	8.833
	SRR8316905	Silver flowering stage	4.177
	SRR8316906	Gold flowering stage	11.141
	SRR8316907	Gold flowering stage	14.206
	SRR8316908	Gold flowering stage	19.433
SRP132670	SRR6706286	Control	24.068
	SRR6706287	Light intensity 50%	22.267
	SRR6706288	Light intensity 20%	24.788
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	55.333
	CNS0095593	Slightly white alabastrum(diploid) 2	61.464
	CNS0095594	Slightly white alabastrum(diploid) 3	52.157
	CNS0095595	Whole white alabastrum(diploid) 2	38.280
	CNS0095596	Whole white alabastrum(diploid) 3	39.504
	CNS0095597	Whole white alabastrum(diploid) 4	40.298
	CNS0095598	Silvery flower (diploied) 1	39.833
	CNS0095599	Silvery flower (diploied) 2	42.302
	CNS0095600	Silvery flower (diploied) 3	27.423
	CNS0095601	Golden flower (diploid) 1	31.129
	CNS0095602	Golden flower (diploid) 2	28.595
	CNS0095603	Golden flower (diploid) 3	32.035
	CNS0095604	Slightly white alabastrum(tetraploid) 1	54.983
	CNS0095605	Slightly white alabastrum(tetraploid) 2	47.646
	CNS0095606	Slightly white alabastrum(tetraploid) 3	76.903
	CNS0095607	Whole white alabastrum(tetraploid) 1	32.161
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.562
	CNS0095609	Whole white alabastrum(tetraploid) 3	37.591
	CNS0095610	Silvery flower (tetraploid) 1	25.973
	CNS0095611	Silvery flower (tetraploid) 2	35.392
	CNS0095612	Silvery flower (tetraploid) 3	27.933
	CNS0095613	Golden flower (tetraploid) 1	28.874
	CNS0095614	Golden flower (tetraploid) 2	32.912
	CNS0095615	Golden flower (tetraploid) 3	19.115
CRA001975	CRR073297	Stem 1	38.218
	CRR073298	Stem 2	41.988
	CRR073299	Stem 3	57.193
	CRR073300	Leaf 1	33.943
	CRR073301	Leaf 2	34.427
	CRR073302	Leaf 3	37.823
	CRR073303	Juvenile bud 1	36.651
	CRR073304	Juvenile bud 2	30.202
	CRR073305	Juvenile bud 3	32.363
	CRR073306	Third green 1	6.192
	CRR073307	Third green 2	12.991
	CRR073308	Third green 3	7.952
	CRR073309	Second white 1	11.637
	CRR073310	Second white 2	8.553
	CRR073311	Second white 3	6.238
	CRR073312	Silver flowering 1	10.255
	CRR073313	Silver flowering 2	10.709
	CRR073314	Silver flowering 3	6.826
	CRR073315	Gold flowering 1	17.583
	CRR073316	Gold flowering 2	14.896
	CRR073317	Gold flowering 3	20.034
	CRR073318	Tawny withering 1	42.508
	CRR073319	Tawny withering 2	40.285
	CRR073320	Tawny withering 3	53.116