Gene detail

Detail information of GWHGAAZE024811

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004306657.1	1.9403E-102	PREDICTED: transcription factor bHLH13-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q9ZPY8\|AIB_ARATH	8E-73	Transcription factor ABA-INDUCIBLE bHLH-TYPE
trEMBL	tr\|M0ZH37\|M0ZH37_SOLTU	1E-102	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400000653}
TAIR10	AT2G46510.1	6E-62	ABA-inducible BHLH-type transcription factor

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	49952782	49953420	+
GWHAAZE00000007	mRNA	49952782	49953420	+
GWHAAZE00000007	exon	49952782	49953087	+
GWHAAZE00000007	exon	49953124	49953420	+
GWHAAZE00000007	CDS	49952782	49953087	+
GWHAAZE00000007	CDS	49953124	49953420	+

Transcript Sequence
>GWHTAAZE024845 ATGACCATTGAGTCTGAGCATTCTGATGCTGAGGCTTCTTGCAAGGAAGAGAGAAGGGGCCTTGCTGACGAAAAGCGGCCTCGAAAACGGGGCCGAAAACCGGCAAATGGAAGAGAAGAACCACTCAATCATGTTGAAGCAGAGAGGCAAAGGAGAGAGAAGCTGAACCAACGGTTCTACGCATTACGAGCTGTTGTGCCCAATATTTCGAAGATGGACAAAGCCTCTCTTTTGGGTGATGCCATTGCTTACATAACCGAGCTTCAAAAGAAGCTCAAAGACATGGAGTTAGAGAGAGAGAAAATGAACCCTACTTCCGAAAATCAAAGCAGAGTGCCCGAGATTGATATCCAAGCTGGCCATGATGAAGTAATTGTAAGGGTGATGTGCCCTTTGGATACTCATCCTGCATCAAGTGTCATACAAGTGCTTAAGGAAGCACAGGTCACTGTTCTTGATTCGAAGCTCGCTGCCACTAACGATTCAGTGTTTCACACATTCATCATCAAGTCTCAAGGATCAGAGCAGCTAACCAAGGAGAAGTTGACTGCAGCGTTTTCCCGTGAATCGAATTGCTTACAGTCTTTATCATCAGTTGGGTAA

Network for GWHGAAZE024811

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00010.27	HLH	43	89	2.90E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bHLH

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.387
	SRR3591706	second leaf	19.135
	SRR3591707	mature leaf	26.073
	SRR3591708	Shoot apex	30.116
	SRR3591709	Stem	32.293
	SRR3591710	White floral bud	25.224
	SRR3591711	White flower	20.843
	SRR3591712	Green floral bud	18.646
	SRR3591713	Yellow flower	4.436
SRP173429	SRR8316895	Juvenile bud stage	40.741
	SRR8316896	Juvenile bud stage	12.592
	SRR8316897	Juvenile bud stage	34.083
	SRR8316894	Third green stage	2.367
	SRR8316900	Third green stage	4.367
	SRR8316901	Third green stage	11.804
	SRR8316898	Complete white stage	3.257
	SRR8316899	Complete white stage	65.202
	SRR8316903	Complete white stage	4.425
	SRR8316902	Silver flowering stage	1.324
	SRR8316904	Silver flowering stage	2.002
	SRR8316905	Silver flowering stage	1.139
	SRR8316906	Gold flowering stage	5.075
	SRR8316907	Gold flowering stage	3.124
	SRR8316908	Gold flowering stage	6.571
SRP132670	SRR6706286	Control	2.622
	SRR6706287	Light intensity 50%	4.606
	SRR6706288	Light intensity 20%	4.497
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.103
	CNS0095593	Slightly white alabastrum(diploid) 2	40.172
	CNS0095594	Slightly white alabastrum(diploid) 3	46.904
	CNS0095595	Whole white alabastrum(diploid) 2	29.314
	CNS0095596	Whole white alabastrum(diploid) 3	5.059
	CNS0095597	Whole white alabastrum(diploid) 4	22.584
	CNS0095598	Silvery flower (diploied) 1	58.434
	CNS0095599	Silvery flower (diploied) 2	72.893
	CNS0095600	Silvery flower (diploied) 3	18.443
	CNS0095601	Golden flower (diploid) 1	69.877
	CNS0095602	Golden flower (diploid) 2	52.014
	CNS0095603	Golden flower (diploid) 3	47.131
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.595
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.823
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.582
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.668
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.876
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.248
	CNS0095610	Silvery flower (tetraploid) 1	2.029
	CNS0095611	Silvery flower (tetraploid) 2	1.302
	CNS0095612	Silvery flower (tetraploid) 3	7.886
	CNS0095613	Golden flower (tetraploid) 1	1.455
	CNS0095614	Golden flower (tetraploid) 2	1.447
	CNS0095615	Golden flower (tetraploid) 3	1.887
CRA001975	CRR073297	Stem 1	46.078
	CRR073298	Stem 2	38.810
	CRR073299	Stem 3	42.480
	CRR073300	Leaf 1	39.638
	CRR073301	Leaf 2	40.509
	CRR073302	Leaf 3	23.448
	CRR073303	Juvenile bud 1	23.301
	CRR073304	Juvenile bud 2	53.308
	CRR073305	Juvenile bud 3	44.667
	CRR073306	Third green 1	5.814
	CRR073307	Third green 2	10.000
	CRR073308	Third green 3	8.086
	CRR073309	Second white 1	7.476
	CRR073310	Second white 2	6.022
	CRR073311	Second white 3	4.557
	CRR073312	Silver flowering 1	10.086
	CRR073313	Silver flowering 2	8.508
	CRR073314	Silver flowering 3	8.967
	CRR073315	Gold flowering 1	40.943
	CRR073316	Gold flowering 2	95.713
	CRR073317	Gold flowering 3	94.082
	CRR073318	Tawny withering 1	74.640
	CRR073319	Tawny withering 2	372.406
	CRR073320	Tawny withering 3	70.707