Gene detail

Detail information of GWHGAAZE024787

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002315404.2	5.68265E-45	hypothetical protein POPTR_0010s25300g [Populus trichocarpa]
COG	YP_003474183.1	2E-10	oxidoreductase FAD-binding domain-containing protein
Swissprot	tr\|Q9ZNT1\|NB5R1_ARATH	1E-43	NADH--cytochrome b5 reductase 1
trEMBL	tr\|B9HVG3\|B9HVG3_POPTR	2E-45	NADH-cytochrome b5 reductase {ECO:0000256\|RuleBase:RU361226}
TAIR10	AT5G17770.1	2E-36	NADH:cytochrome B5 reductase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	49406142	49408456	-
GWHAAZE00000007	mRNA	49406142	49408456	-
GWHAAZE00000007	exon	49408379	49408456	-
GWHAAZE00000007	exon	49406547	49406627	-
GWHAAZE00000007	exon	49406364	49406453	-
GWHAAZE00000007	exon	49406142	49406243	-
GWHAAZE00000007	CDS	49408379	49408456	-
GWHAAZE00000007	CDS	49406547	49406627	-
GWHAAZE00000007	CDS	49406364	49406453	-
GWHAAZE00000007	CDS	49406142	49406243	-

Transcript Sequence
>GWHTAAZE024821 ATGTATCCAAAGGGAAGGATGTCACATTATTTCAGAGAGATGCGCGAAGGGATTCGGCTAGGCGTGAAGGGACCAGCGGGGCGTTTCACATACAAACCAGGCCAGGTAAGAGCATTTGGGATGCTTGCTGGAGGAAGTGGCATTACACCAATGTTTCAGCTCACTAGAGCCATATTGGAAAATCCGAAAGATAAAACCAAGGTGCATCTTATCTATGCTAATACTACATTTGAGGATATTCTTTTGAAGAAAAACCTAGGTTGTTGGGACCTTTGGTCTTCAAAACGCCTTATGCCTGTAAATCCAAAATTGATTAGGACAAGAAATCGGAAACCAAATACTGGTGGTTGA

Network for GWHGAAZE024787

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00970.25	FAD_binding_6	1	31	0.00014
PF00175.22	NAD_binding_1	41	90	3.30E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00326	E1.6.2.2	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.672
	SRR3591706	second leaf	2.738
	SRR3591707	mature leaf	0.933
	SRR3591708	Shoot apex	1.175
	SRR3591709	Stem	4.293
	SRR3591710	White floral bud	0.306
	SRR3591711	White flower	0.857
	SRR3591712	Green floral bud	0.729
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.981
	SRR8316896	Juvenile bud stage	1.147
	SRR8316897	Juvenile bud stage	0.460
	SRR8316894	Third green stage	0.580
	SRR8316900	Third green stage	0.558
	SRR8316901	Third green stage	1.316
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.394
	SRR8316903	Complete white stage	0.054
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.580
	SRR6706287	Light intensity 50%	0.625
	SRR6706288	Light intensity 20%	0.469
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.704
	CNS0095593	Slightly white alabastrum(diploid) 2	4.419
	CNS0095594	Slightly white alabastrum(diploid) 3	2.840
	CNS0095595	Whole white alabastrum(diploid) 2	1.245
	CNS0095596	Whole white alabastrum(diploid) 3	0.219
	CNS0095597	Whole white alabastrum(diploid) 4	0.025
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.098
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.285
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.018
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.610
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.125
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.963
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.008
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.166
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.059
CRA001975	CRR073297	Stem 1	0.348
	CRR073298	Stem 2	0.656
	CRR073299	Stem 3	0.281
	CRR073300	Leaf 1	0.789
	CRR073301	Leaf 2	0.708
	CRR073302	Leaf 3	0.602
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.056
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.087
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.243
	CRR073318	Tawny withering 1	1.208
	CRR073319	Tawny withering 2	0.656
	CRR073320	Tawny withering 3	0.491