Gene detail

Detail information of GWHGAAZE024710

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011088709.1	3.11034E-29	PREDICTED: putative receptor-like protein kinase At5g39000 isoform X2 [Sesamum indicum]
Swissprot	tr\|Q9SCZ4\|FERON_ARATH	2E-21	Receptor-like protein kinase FERONIA (Precursor)
trEMBL	tr\|A0A022RIC5\|A0A022RIC5_ERYGU	8E-29	Uncharacterized protein {ECO:0000313\|EMBL:EYU40182.1} (Fragment)
TAIR10	AT3G51550.1	2E-19	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	47986434	47986967	-
GWHAAZE00000007	mRNA	47986434	47986967	-
GWHAAZE00000007	exon	47986434	47986967	-
GWHAAZE00000007	CDS	47986434	47986967	-

Transcript Sequence
>GWHTAAZE024744 ATGTCATCCATCACCCGATTCTTGCCAATTCTGGCCTTTCTCTTCTTCCTCGAGCATTCAGTTCATACCTTGGCAGGTAATTTTCCAACTCCCCATTCTTCCATTGATAACTTTGCCAATTATGACCATTGTCACTCGGGCATGCATCTAGTAACCCAAGATTCCATTCATTCGGCTCCAAAGCTACGAAAACAAGCTTTTGGAGTTGTAAACACGATTGCGACTGGTGTTACAATTGTAATCACAATACTGAATATTGTTGTTTATAAGTTGCGGGAAATTCACGAAGCAAATCTTCGTGAGAAATATACACCGTCAGAACAATTATGTCGCCGATTTTTACTTGCTGATATACTATTAGCAACCGAAAACTTTGAAGATTCATTGGTTATCGGCCAGGGTGGATTTGGAAAGGTATACAAAGGGGTAATAGATGATGGCACAGTTACTGTTGCCATAAAGCGATTGAATCCCATGTCCAAGCAAGGATCTCTCGAGTTTTGGGCAGAAATTGAGATGTTGTCTAGAATTTGA

Network for GWHGAAZE024710

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.876
	SRR3591706	second leaf	1.694
	SRR3591707	mature leaf	4.093
	SRR3591708	Shoot apex	2.701
	SRR3591709	Stem	3.367
	SRR3591710	White floral bud	3.114
	SRR3591711	White flower	6.326
	SRR3591712	Green floral bud	2.565
	SRR3591713	Yellow flower	2.150
SRP173429	SRR8316895	Juvenile bud stage	1.000
	SRR8316896	Juvenile bud stage	0.777
	SRR8316897	Juvenile bud stage	0.378
	SRR8316894	Third green stage	1.014
	SRR8316900	Third green stage	1.656
	SRR8316901	Third green stage	1.417
	SRR8316898	Complete white stage	0.460
	SRR8316899	Complete white stage	3.981
	SRR8316903	Complete white stage	2.805
	SRR8316902	Silver flowering stage	1.047
	SRR8316904	Silver flowering stage	1.979
	SRR8316905	Silver flowering stage	0.605
	SRR8316906	Gold flowering stage	2.460
	SRR8316907	Gold flowering stage	1.921
	SRR8316908	Gold flowering stage	1.471
SRP132670	SRR6706286	Control	0.346
	SRR6706287	Light intensity 50%	0.573
	SRR6706288	Light intensity 20%	0.751
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.425
	CNS0095593	Slightly white alabastrum(diploid) 2	0.177
	CNS0095594	Slightly white alabastrum(diploid) 3	0.850
	CNS0095595	Whole white alabastrum(diploid) 2	0.165
	CNS0095596	Whole white alabastrum(diploid) 3	0.247
	CNS0095597	Whole white alabastrum(diploid) 4	0.330
	CNS0095598	Silvery flower (diploied) 1	3.522
	CNS0095599	Silvery flower (diploied) 2	2.694
	CNS0095600	Silvery flower (diploied) 3	2.692
	CNS0095601	Golden flower (diploid) 1	1.395
	CNS0095602	Golden flower (diploid) 2	4.159
	CNS0095603	Golden flower (diploid) 3	4.284
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.261
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.914
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.787
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.319
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.641
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.900
	CNS0095610	Silvery flower (tetraploid) 1	2.268
	CNS0095611	Silvery flower (tetraploid) 2	4.881
	CNS0095612	Silvery flower (tetraploid) 3	1.858
	CNS0095613	Golden flower (tetraploid) 1	1.193
	CNS0095614	Golden flower (tetraploid) 2	3.410
	CNS0095615	Golden flower (tetraploid) 3	2.078
CRA001975	CRR073297	Stem 1	2.130
	CRR073298	Stem 2	0.561
	CRR073299	Stem 3	0.482
	CRR073300	Leaf 1	0.057
	CRR073301	Leaf 2	0.216
	CRR073302	Leaf 3	0.039
	CRR073303	Juvenile bud 1	0.264
	CRR073304	Juvenile bud 2	0.266
	CRR073305	Juvenile bud 3	0.229
	CRR073306	Third green 1	0.219
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.125
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.400
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.563
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.236
	CRR073319	Tawny withering 2	0.196
	CRR073320	Tawny withering 3	0.341