Gene detail

Detail information of GWHGAAZE024669

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010263394.1	3.9817E-104	PREDICTED: UDP-N-acetylglucosamine transferase subunit ALG13 homolog [Nelumbo nucifera]
COG	YP_004772690.1	1E-14	glycosyltransferase domain-containing protein
trEMBL	tr\|A0A067JHW6\|A0A067JHW6_JATCU	5E-104	Uncharacterized protein {ECO:0000313\|EMBL:KDP23541.1}
TAIR10	AT4G16710.2	4E-65	glycosyltransferase family protein 28

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	47331446	47334706	+
GWHAAZE00000007	mRNA	47331446	47334706	+
GWHAAZE00000007	exon	47331446	47331631	+
GWHAAZE00000007	exon	47332796	47332895	+
GWHAAZE00000007	exon	47334450	47334706	+
GWHAAZE00000007	CDS	47331446	47331631	+
GWHAAZE00000007	CDS	47332796	47332895	+
GWHAAZE00000007	CDS	47334450	47334706	+

Transcript Sequence
>GWHTAAZE024703 ATGGGTGATGGTGATATTGATGAAAGTTCAAAACCGAAGAGGATAGTTTTCGTGACTGTTGGGACCACCTCTTTTGATTCTCTTGTTAGAGCAGTGGATACTCTTGAAGTTAAAGAAGAATTGTCAAAAAGAGGATATACTCATCTTCTTATTCAAATGGGTCGTGGATCCTACTTTCCTACAAAGTCTAATAGTGAGGATGGGTCCTTGGCAGTAGACTACTTCACATTTTCTTCAAGCATTGCTGACAGTTTGAGATCCGCATCCCTTGTTATAAGTCATGCAGGTTCAGGGAGTATATTTGAGACATTGCAATTGGGCAAGCCGTTAATTGTGGTAGTAAATGAGGACTTGATGGACAATCATCAAAGTGAGCTAGCAGAAGAACTAGCCGAGAGGAAGCATTTGTTTTGCACTCGCCCTCAAACGCTTCACCAGGTTATTTCTTCTATGGATTTGAATTCCCTCATCCCTTACCCCTCAGGTGATGCTACACCTGTTGCAAAGCTCATAAATAGATTTCTTGGGTTTCCAGATGATTGA

Network for GWHGAAZE024669

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04101.17	Glyco_tran_28_C	15	171	1.80E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07432	ALG13	Metabolic pathways	map01100
		N-Glycan biosynthesis	map00510
		Various types of N-glycan biosynthesis	map00513

Gene Ontology

GO term	Ontology	Name
GO:0016758	molecular_function	transferase activity, transferring hexosyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.833
	SRR3591706	second leaf	13.086
	SRR3591707	mature leaf	11.723
	SRR3591708	Shoot apex	13.196
	SRR3591709	Stem	13.911
	SRR3591710	White floral bud	9.112
	SRR3591711	White flower	12.979
	SRR3591712	Green floral bud	25.519
	SRR3591713	Yellow flower	9.690
SRP173429	SRR8316895	Juvenile bud stage	14.118
	SRR8316896	Juvenile bud stage	26.321
	SRR8316897	Juvenile bud stage	12.642
	SRR8316894	Third green stage	10.743
	SRR8316900	Third green stage	22.277
	SRR8316901	Third green stage	18.786
	SRR8316898	Complete white stage	6.687
	SRR8316899	Complete white stage	23.881
	SRR8316903	Complete white stage	12.012
	SRR8316902	Silver flowering stage	8.571
	SRR8316904	Silver flowering stage	11.241
	SRR8316905	Silver flowering stage	5.908
	SRR8316906	Gold flowering stage	17.957
	SRR8316907	Gold flowering stage	19.428
	SRR8316908	Gold flowering stage	16.147
SRP132670	SRR6706286	Control	0.975
	SRR6706287	Light intensity 50%	1.186
	SRR6706288	Light intensity 20%	1.489
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.600
	CNS0095593	Slightly white alabastrum(diploid) 2	30.459
	CNS0095594	Slightly white alabastrum(diploid) 3	26.661
	CNS0095595	Whole white alabastrum(diploid) 2	23.329
	CNS0095596	Whole white alabastrum(diploid) 3	18.271
	CNS0095597	Whole white alabastrum(diploid) 4	19.687
	CNS0095598	Silvery flower (diploied) 1	19.942
	CNS0095599	Silvery flower (diploied) 2	21.579
	CNS0095600	Silvery flower (diploied) 3	16.720
	CNS0095601	Golden flower (diploid) 1	21.976
	CNS0095602	Golden flower (diploid) 2	13.385
	CNS0095603	Golden flower (diploid) 3	11.444
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.072
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.363
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.315
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.024
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.767
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.574
	CNS0095610	Silvery flower (tetraploid) 1	8.175
	CNS0095611	Silvery flower (tetraploid) 2	11.048
	CNS0095612	Silvery flower (tetraploid) 3	17.232
	CNS0095613	Golden flower (tetraploid) 1	8.219
	CNS0095614	Golden flower (tetraploid) 2	9.754
	CNS0095615	Golden flower (tetraploid) 3	5.260
CRA001975	CRR073297	Stem 1	9.054
	CRR073298	Stem 2	7.401
	CRR073299	Stem 3	6.065
	CRR073300	Leaf 1	8.210
	CRR073301	Leaf 2	7.638
	CRR073302	Leaf 3	3.943
	CRR073303	Juvenile bud 1	4.375
	CRR073304	Juvenile bud 2	3.850
	CRR073305	Juvenile bud 3	4.981
	CRR073306	Third green 1	0.308
	CRR073307	Third green 2	0.634
	CRR073308	Third green 3	0.689
	CRR073309	Second white 1	4.769
	CRR073310	Second white 2	2.801
	CRR073311	Second white 3	3.188
	CRR073312	Silver flowering 1	2.545
	CRR073313	Silver flowering 2	2.952
	CRR073314	Silver flowering 3	1.919
	CRR073315	Gold flowering 1	3.462
	CRR073316	Gold flowering 2	4.542
	CRR073317	Gold flowering 3	1.226
	CRR073318	Tawny withering 1	6.692
	CRR073319	Tawny withering 2	4.084
	CRR073320	Tawny withering 3	10.150