Gene detail

Detail information of GWHGAAZE024656

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006474161.1	9.0652E-105	PREDICTED: probable xyloglucan endotransglucosylase/hydrolase protein 23-like [Citrus sinensis]
Swissprot	tr\|P24806\|XTH24_ARATH	3E-94	Xyloglucan endotransglucosylase/hydrolase protein 24 (Precursor)
trEMBL	tr\|F6GXD4\|F6GXD4_VITVI	3E-105	Xyloglucan endotransglucosylase/hydrolase {ECO:0000256\|RuleBase:RU361120}
TAIR10	AT4G30270.1	9E-76	xyloglucan endotransglucosylase/hydrolase 24

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	47160102	47161106	-
GWHAAZE00000007	mRNA	47160102	47161106	-
GWHAAZE00000007	exon	47160831	47161106	-
GWHAAZE00000007	exon	47160562	47160661	-
GWHAAZE00000007	exon	47160102	47160439	-
GWHAAZE00000007	CDS	47160831	47161106	-
GWHAAZE00000007	CDS	47160562	47160661	-
GWHAAZE00000007	CDS	47160102	47160439	-

Transcript Sequence
>GWHTAAZE024690 ATGGCGGTTTCGTCTTCTATTTCAATTGGGTTGATGATATCTCTCATGTTTGGCTCCATAATGGTGGCTTCAGCATCCAACCTCTACCAAGACTTTGATGTTACTTGGGGCGATGGCCGTGGTAAGATATTCAACAATGGCGATCTCCTCACTCTCTCTCTTGACAAAGCCTCTGGCTCCGGCTTCCAGTCCAAACACGAATATCTGTTTGGAAAGATTGATATGCAGATTAAACTCGTACCTGGAAACTCCGCCGGCACTGTTACAGCTTATTACGCCAAGGCAAAGGAGAAAGAGAGCAACAATTCCATCTTTGGTTTGACCCAACCGCTGATTTCCATACATACTCAATCCTTTGGAACCCCCAACGCATTATATGGCACACCAATCAGAGAGTTCAAGAACGCCGAGTCTATTGGCGTACCATACCCAAAGAACCAACCGATGAGGATATACTCTAGCCTATGGAATGCCGATGATTGGGCGACAAGAGGTGGGCTCGTGAAGACTGATTGGACTCAAGCTCCTTTCACCGCGTCTTACAGAAACTTCAAAGCCGAAGCTTCAAACAACGGGGCATGGCTCACGGAAGAGTTGGACTCGACGAGCCAGGGGAGGTTGAAATGGGTGCAAAAGAACTATATGATCTACAATTACTGCACAGACATAAAGAGATATCCTCAAGGCCTACCCAAAGAATGCAGCATGTACTAA

Network for GWHGAAZE024656

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00722.22	Glyco_hydro_16	30	97	8.30E-13
PF00722.22	Glyco_hydro_16	127	173	1.80E-10
PF06955.13	XET_C	190	234	2.60E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14504	TCH4	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0010411	biological_process	xyloglucan metabolic process
GO:0042546	biological_process	cell wall biogenesis
GO:0006073	biological_process	cellular glucan metabolic process
GO:0005975	biological_process	carbohydrate metabolic process
GO:0005618	cellular_component	cell wall
GO:0048046	cellular_component	apoplast
GO:0016762	molecular_function	xyloglucan:xyloglucosyl transferase activity
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	141.339
	SRR3591706	second leaf	2.163
	SRR3591707	mature leaf	1.388
	SRR3591708	Shoot apex	20.293
	SRR3591709	Stem	87.660
	SRR3591710	White floral bud	5.229
	SRR3591711	White flower	4.869
	SRR3591712	Green floral bud	2.983
	SRR3591713	Yellow flower	17.955
SRP173429	SRR8316895	Juvenile bud stage	0.036
	SRR8316896	Juvenile bud stage	0.278
	SRR8316897	Juvenile bud stage	0.593
	SRR8316894	Third green stage	0.039
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.409
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.026
	SRR8316903	Complete white stage	0.101
	SRR8316902	Silver flowering stage	0.030
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.003
	SRR8316906	Gold flowering stage	0.038
	SRR8316907	Gold flowering stage	0.294
	SRR8316908	Gold flowering stage	0.374
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.001
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.094
	CNS0095593	Slightly white alabastrum(diploid) 2	0.087
	CNS0095594	Slightly white alabastrum(diploid) 3	0.301
	CNS0095595	Whole white alabastrum(diploid) 2	0.163
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.008
	CNS0095598	Silvery flower (diploied) 1	0.699
	CNS0095599	Silvery flower (diploied) 2	0.134
	CNS0095600	Silvery flower (diploied) 3	0.054
	CNS0095601	Golden flower (diploid) 1	0.263
	CNS0095602	Golden flower (diploid) 2	0.023
	CNS0095603	Golden flower (diploid) 3	0.487
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.015
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.163
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.069
	CNS0095613	Golden flower (tetraploid) 1	0.273
	CNS0095614	Golden flower (tetraploid) 2	0.227
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.214
	CRR073298	Stem 2	0.082
	CRR073299	Stem 3	0.053
	CRR073300	Leaf 1	0.020
	CRR073301	Leaf 2	0.016
	CRR073302	Leaf 3	0.020
	CRR073303	Juvenile bud 1	0.004
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.528
	CRR073306	Third green 1	0.283
	CRR073307	Third green 2	0.403
	CRR073308	Third green 3	0.500
	CRR073309	Second white 1	0.169
	CRR073310	Second white 2	0.163
	CRR073311	Second white 3	0.035
	CRR073312	Silver flowering 1	0.064
	CRR073313	Silver flowering 2	0.071
	CRR073314	Silver flowering 3	0.147
	CRR073315	Gold flowering 1	0.701
	CRR073316	Gold flowering 2	5.357
	CRR073317	Gold flowering 3	1.006
	CRR073318	Tawny withering 1	4.863
	CRR073319	Tawny withering 2	4.094
	CRR073320	Tawny withering 3	7.455