Gene detail

Detail information of GWHGAAZE024627

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009801801.1	2.70615E-47	PREDICTED: probable signal peptidase complex subunit 1 [Nicotiana sylvestris]
Swissprot	tr\|Q944J0\|SPCS1_ARATH	4E-41	Probable signal peptidase complex subunit 1
trEMBL	tr\|I1MYG5\|I1MYG5_SOYBN	2E-47	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA18G01120.1}
TAIR10	AT4G40042.1	3E-32	Microsomal signal peptidase 12 kDa subunit (SPC12)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	46536472	46538008	+
GWHAAZE00000007	mRNA	46536472	46538008	+
GWHAAZE00000007	exon	46537515	46538008	+
GWHAAZE00000007	exon	46536472	46536503	+
GWHAAZE00000007	five_prime_UTR	46536472	46536503	+
GWHAAZE00000007	CDS	46537515	46537793	+
GWHAAZE00000007	three_prime_UTR	46537794	46538008	+

Transcript Sequence
>GWHTAAZE024661 TCAGACTCACTAGATTGAGCAACAGTTGAAAGATGGATTGGCAAGGGCAAAAGCTAGTGGAGCAGCTAATGCAGATAATGCTAGTGTCCTTCGCTGTGGTGGCATTTGCAACCGGCTATGCTTTGGGTTCGTTCCGAATGATGCTGCTTATATATGCTGGTGGAGTCGTTTTGACTACGCTTATCACCGTTCCCAATTGGCCTTTCTTCAATCGCCACCCTCTAAAGTGGCTGGACCCGAGTGTTGTTGATAAGCATCCAAAGCCGCAGCTTGCTAATTCTAATTCGAAGAAGAAATCCATTAAGAAATAAGAAATAGGTAACTTTTTTCGCTGATTTCTGATCTGTTTTCTGCTACTGTTTTTGTTATCTGGGATGTATGAAGTGCCTGTGACTTTGTTCTTTTAATGGATTACATTGCTTTTGCTCTTTGGAAATTTGTAGTTCTAGCTTATTCTAAATGTTACAACTTCGTACAATGACCTGATGGAAGTAAAAATTCTACATTAGCCTTGATCTAAAATCAA

Network for GWHGAAZE024627

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06645.14	SPC12	1	70	9.70E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12946	SPCS1	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006465	biological_process	signal peptide processing
GO:0005787	cellular_component	signal peptidase complex
GO:0016021	cellular_component	integral component of membrane
GO:0008233	molecular_function	peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	68.884
	SRR3591706	second leaf	35.963
	SRR3591707	mature leaf	30.137
	SRR3591708	Shoot apex	72.222
	SRR3591709	Stem	49.484
	SRR3591710	White floral bud	52.724
	SRR3591711	White flower	44.000
	SRR3591712	Green floral bud	68.069
	SRR3591713	Yellow flower	34.098
SRP173429	SRR8316895	Juvenile bud stage	40.985
	SRR8316896	Juvenile bud stage	57.441
	SRR8316897	Juvenile bud stage	26.552
	SRR8316894	Third green stage	20.565
	SRR8316900	Third green stage	89.427
	SRR8316901	Third green stage	82.927
	SRR8316898	Complete white stage	26.036
	SRR8316899	Complete white stage	80.815
	SRR8316903	Complete white stage	37.499
	SRR8316902	Silver flowering stage	20.742
	SRR8316904	Silver flowering stage	26.158
	SRR8316905	Silver flowering stage	10.075
	SRR8316906	Gold flowering stage	34.448
	SRR8316907	Gold flowering stage	41.516
	SRR8316908	Gold flowering stage	38.196
SRP132670	SRR6706286	Control	34.070
	SRR6706287	Light intensity 50%	28.560
	SRR6706288	Light intensity 20%	33.813
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	141.254
	CNS0095593	Slightly white alabastrum(diploid) 2	167.573
	CNS0095594	Slightly white alabastrum(diploid) 3	154.271
	CNS0095595	Whole white alabastrum(diploid) 2	136.920
	CNS0095596	Whole white alabastrum(diploid) 3	154.867
	CNS0095597	Whole white alabastrum(diploid) 4	139.569
	CNS0095598	Silvery flower (diploied) 1	92.486
	CNS0095599	Silvery flower (diploied) 2	88.993
	CNS0095600	Silvery flower (diploied) 3	70.766
	CNS0095601	Golden flower (diploid) 1	85.085
	CNS0095602	Golden flower (diploid) 2	68.438
	CNS0095603	Golden flower (diploid) 3	70.907
	CNS0095604	Slightly white alabastrum(tetraploid) 1	120.591
	CNS0095605	Slightly white alabastrum(tetraploid) 2	131.123
	CNS0095606	Slightly white alabastrum(tetraploid) 3	97.949
	CNS0095607	Whole white alabastrum(tetraploid) 1	117.643
	CNS0095608	Whole white alabastrum(tetraploid) 2	112.643
	CNS0095609	Whole white alabastrum(tetraploid) 3	95.820
	CNS0095610	Silvery flower (tetraploid) 1	66.326
	CNS0095611	Silvery flower (tetraploid) 2	60.738
	CNS0095612	Silvery flower (tetraploid) 3	44.020
	CNS0095613	Golden flower (tetraploid) 1	53.343
	CNS0095614	Golden flower (tetraploid) 2	58.832
	CNS0095615	Golden flower (tetraploid) 3	40.657
CRA001975	CRR073297	Stem 1	46.693
	CRR073298	Stem 2	50.303
	CRR073299	Stem 3	53.613
	CRR073300	Leaf 1	61.455
	CRR073301	Leaf 2	66.569
	CRR073302	Leaf 3	75.167
	CRR073303	Juvenile bud 1	68.078
	CRR073304	Juvenile bud 2	65.931
	CRR073305	Juvenile bud 3	44.478
	CRR073306	Third green 1	15.581
	CRR073307	Third green 2	25.287
	CRR073308	Third green 3	17.629
	CRR073309	Second white 1	25.146
	CRR073310	Second white 2	14.848
	CRR073311	Second white 3	10.863
	CRR073312	Silver flowering 1	11.927
	CRR073313	Silver flowering 2	17.042
	CRR073314	Silver flowering 3	11.218
	CRR073315	Gold flowering 1	62.151
	CRR073316	Gold flowering 2	36.147
	CRR073317	Gold flowering 3	35.896
	CRR073318	Tawny withering 1	63.268
	CRR073319	Tawny withering 2	65.263
	CRR073320	Tawny withering 3	67.818