Gene detail

Detail information of GWHGAAZE024500

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007204744.1	5.8177E-118	hypothetical protein PRUPE_ppa012308mg [Prunus persica]
Swissprot	tr\|Q1ECJ7\|ARPC3_ARATH	1E-114	Actin-related protein 2/3 complex subunit 3
trEMBL	tr\|M5W9K5\|M5W9K5_PRUPE	2E-118	Actin-related protein 2/3 complex subunit 3 {ECO:0000256\|PIRNR:PIRNR016315}
TAIR10	AT1G60430.2	3E-90	actin-related protein C3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	43741844	43743148	-
GWHAAZE00000007	mRNA	43741844	43743148	-
GWHAAZE00000007	exon	43741844	43741992	-
GWHAAZE00000007	exon	43742683	43742952	-
GWHAAZE00000007	exon	43743040	43743148	-
GWHAAZE00000007	CDS	43743040	43743148	-
GWHAAZE00000007	CDS	43742683	43742952	-
GWHAAZE00000007	CDS	43741844	43741992	-

Transcript Sequence
>GWHTAAZE024534 GTTTACCACTCTAGTTTCGTTGACGAGGAAGGAATTGCTAGAGCCTGTGGGTGTCCTCTACTTCCTCTAAAAAGCCATATAAAGGGACCTGCTCCAGTTTCCGATCAAGATAGAACTGATATAGTCGATGAAGCAATCACATTCTTTCGTGCCAATGTCTTCTTCAGAAACTTTGACATTAAAAGCTCGGCTGATAAGCTCCTTATTTATTTGACATTTTATATCAATGTGGCTTTGAAAAGGCTTGAAGGCTGCAGAACTTTGGCCGAAGGGACCAAGGCAATTATTAACCTGGGCCTTGAAAATGTTCCTGTCCCTGGGGAATCAAGTTTCCCCTTTCCAGGTCTCTTTGTCCTACCTCAATCTCAGAAAGAAGCAGAGCTACTGAGGAATTATCTGAAGCAAATAAGAGAGGAAACAAGTGGGAGACTATTGAGTGTTGCTTATAGACCCAATGGTACTCCAAATAAATGGTGGTTAGCATTTGCCAAGAGAAAGTTTATGAATATTATTGTTCCTTCGTCATAG

Network for GWHGAAZE024500

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04062.15	P21-Arc	2	169	7.80E-64

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05756	ARPC3	Endocytosis	map04144
		Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666

Gene Ontology

GO term	Ontology	Name
GO:0030833	biological_process	regulation of actin filament polymerization
GO:0034314	biological_process	Arp2/3 complex-mediated actin nucleation
GO:0005856	cellular_component	cytoskeleton
GO:0005885	cellular_component	Arp2/3 protein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	40.867
	SRR3591706	second leaf	19.062
	SRR3591707	mature leaf	21.615
	SRR3591708	Shoot apex	16.208
	SRR3591709	Stem	50.946
	SRR3591710	White floral bud	45.941
	SRR3591711	White flower	57.916
	SRR3591712	Green floral bud	38.889
	SRR3591713	Yellow flower	58.846
SRP173429	SRR8316895	Juvenile bud stage	26.680
	SRR8316896	Juvenile bud stage	39.828
	SRR8316897	Juvenile bud stage	28.360
	SRR8316894	Third green stage	20.209
	SRR8316900	Third green stage	49.832
	SRR8316901	Third green stage	46.245
	SRR8316898	Complete white stage	35.683
	SRR8316899	Complete white stage	53.771
	SRR8316903	Complete white stage	49.760
	SRR8316902	Silver flowering stage	33.515
	SRR8316904	Silver flowering stage	41.630
	SRR8316905	Silver flowering stage	17.697
	SRR8316906	Gold flowering stage	71.595
	SRR8316907	Gold flowering stage	64.370
	SRR8316908	Gold flowering stage	69.685
SRP132670	SRR6706286	Control	18.045
	SRR6706287	Light intensity 50%	21.229
	SRR6706288	Light intensity 20%	22.990
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.683
	CNS0095593	Slightly white alabastrum(diploid) 2	40.434
	CNS0095594	Slightly white alabastrum(diploid) 3	28.809
	CNS0095595	Whole white alabastrum(diploid) 2	34.902
	CNS0095596	Whole white alabastrum(diploid) 3	38.665
	CNS0095597	Whole white alabastrum(diploid) 4	34.824
	CNS0095598	Silvery flower (diploied) 1	24.869
	CNS0095599	Silvery flower (diploied) 2	27.030
	CNS0095600	Silvery flower (diploied) 3	49.090
	CNS0095601	Golden flower (diploid) 1	27.453
	CNS0095602	Golden flower (diploid) 2	39.770
	CNS0095603	Golden flower (diploid) 3	36.758
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.474
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.498
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.489
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.321
	CNS0095608	Whole white alabastrum(tetraploid) 2	41.808
	CNS0095609	Whole white alabastrum(tetraploid) 3	41.098
	CNS0095610	Silvery flower (tetraploid) 1	61.487
	CNS0095611	Silvery flower (tetraploid) 2	40.434
	CNS0095612	Silvery flower (tetraploid) 3	59.520
	CNS0095613	Golden flower (tetraploid) 1	53.380
	CNS0095614	Golden flower (tetraploid) 2	46.990
	CNS0095615	Golden flower (tetraploid) 3	49.399
CRA001975	CRR073297	Stem 1	17.894
	CRR073298	Stem 2	13.290
	CRR073299	Stem 3	11.810
	CRR073300	Leaf 1	16.399
	CRR073301	Leaf 2	18.283
	CRR073302	Leaf 3	11.092
	CRR073303	Juvenile bud 1	16.828
	CRR073304	Juvenile bud 2	16.809
	CRR073305	Juvenile bud 3	7.851
	CRR073306	Third green 1	18.064
	CRR073307	Third green 2	25.042
	CRR073308	Third green 3	13.276
	CRR073309	Second white 1	18.257
	CRR073310	Second white 2	16.021
	CRR073311	Second white 3	10.895
	CRR073312	Silver flowering 1	14.362
	CRR073313	Silver flowering 2	12.676
	CRR073314	Silver flowering 3	10.982
	CRR073315	Gold flowering 1	7.851
	CRR073316	Gold flowering 2	9.911
	CRR073317	Gold flowering 3	5.079
	CRR073318	Tawny withering 1	11.937
	CRR073319	Tawny withering 2	14.712
	CRR073320	Tawny withering 3	14.878