Gene detail

Detail information of GWHGAAZE024313

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282868.1	2.11779E-76	PREDICTED: aldose 1-epimerase [Vitis vinifera]
COG	YP_008148073.1	3E-38	aldose 1-epimerase
trEMBL	tr\|F6H5Q1\|F6H5Q1_VITVI	8E-77	Aldose 1-epimerase {ECO:0000256\|PIRNR:PIRNR005096}
TAIR10	AT5G15140.1	4E-48	Galactose mutarotase-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39858449	39858967	-
GWHAAZE00000007	mRNA	39858449	39858967	-
GWHAAZE00000007	exon	39858449	39858967	-
GWHAAZE00000007	CDS	39858449	39858967	-

Transcript Sequence
>GWHTAAZE024347 ATGTTGTTATATGCATATACTCTCACCGGATCATACAAACCAAGTGTAAAAATGAAAGCCAAAGCTTTAAACAAAGCCACACCAGTGAACTTAGCTCAACACAGCTATTGGAACCTCGGTGGCCACAACAGTGGCAATATCCTCTCCGATGAGATCCAGATATTCGGGTCACACATTGCTCCCACAGACAAAAACCTCATCCCAACGGGCGAAATCTGGCCCATTAAAGGAACATCGTACGATTTCCTCAAACCACAAGTCCTTTCAAGCAAGATCAACGGCCTTCCTGGCCTTTACGATATCAACTATGTTCTTGATGGTGATAATGGCAACAAGAAGATGAAGCCAGTTGCTAAGGTGCACAATAAGAAGAGTGGAAGAGTGATGGAGCTGTCGAGTGATGCACCCGGGGTGCAGTTTTATACGGGTAATTATCTGAAGGACTTGAAGGGCCAAGGCGGGTTTGTTTATCAAGCTCATGCTGCGCTTTGGTTGGAGACTCAAGGGTTCCCGGACTAG

Network for GWHGAAZE024313

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01263.21	Aldose_epim	3	172	2.70E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01785	galM, GALM	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Glycolysis / Gluconeogenesis	map00010
		Galactose metabolism	map00052

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0030246	molecular_function	carbohydrate binding
GO:0016853	molecular_function	isomerase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.938
	SRR3591706	second leaf	0.311
	SRR3591707	mature leaf	0.479
	SRR3591708	Shoot apex	0.540
	SRR3591709	Stem	0.682
	SRR3591710	White floral bud	2.636
	SRR3591711	White flower	0.141
	SRR3591712	Green floral bud	3.782
	SRR3591713	Yellow flower	0.228
SRP173429	SRR8316895	Juvenile bud stage	0.422
	SRR8316896	Juvenile bud stage	1.589
	SRR8316897	Juvenile bud stage	1.755
	SRR8316894	Third green stage	0.367
	SRR8316900	Third green stage	0.024
	SRR8316901	Third green stage	0.675
	SRR8316898	Complete white stage	0.384
	SRR8316899	Complete white stage	3.468
	SRR8316903	Complete white stage	0.354
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.365
	SRR8316906	Gold flowering stage	0.046
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.335
SRP132670	SRR6706286	Control	2.683
	SRR6706287	Light intensity 50%	2.160
	SRR6706288	Light intensity 20%	1.471
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.623
	CNS0095593	Slightly white alabastrum(diploid) 2	1.678
	CNS0095594	Slightly white alabastrum(diploid) 3	1.148
	CNS0095595	Whole white alabastrum(diploid) 2	0.433
	CNS0095596	Whole white alabastrum(diploid) 3	0.052
	CNS0095597	Whole white alabastrum(diploid) 4	0.330
	CNS0095598	Silvery flower (diploied) 1	1.099
	CNS0095599	Silvery flower (diploied) 2	0.110
	CNS0095600	Silvery flower (diploied) 3	0.522
	CNS0095601	Golden flower (diploid) 1	1.510
	CNS0095602	Golden flower (diploid) 2	0.647
	CNS0095603	Golden flower (diploid) 3	0.821
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.133
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.605
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.573
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.224
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.050
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.811
	CNS0095610	Silvery flower (tetraploid) 1	0.243
	CNS0095611	Silvery flower (tetraploid) 2	0.563
	CNS0095612	Silvery flower (tetraploid) 3	0.997
	CNS0095613	Golden flower (tetraploid) 1	0.757
	CNS0095614	Golden flower (tetraploid) 2	0.252
	CNS0095615	Golden flower (tetraploid) 3	0.250
CRA001975	CRR073297	Stem 1	0.483
	CRR073298	Stem 2	0.139
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.264
	CRR073301	Leaf 2	0.246
	CRR073302	Leaf 3	0.041
	CRR073303	Juvenile bud 1	0.437
	CRR073304	Juvenile bud 2	0.227
	CRR073305	Juvenile bud 3	0.398
	CRR073306	Third green 1	0.145
	CRR073307	Third green 2	0.034
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.023
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.227
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.038
	CRR073316	Gold flowering 2	2.747
	CRR073317	Gold flowering 3	2.277
	CRR073318	Tawny withering 1	2.912
	CRR073319	Tawny withering 2	1.567
	CRR073320	Tawny withering 3	1.451