Gene detail

Detail information of GWHGAAZE024299

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010092050.1	1.8198E-130	40S ribosomal protein S9-2 [Morus notabilis]
COG	YP_001434772.1	2E-35	30S ribosomal protein S4
Swissprot	tr\|Q9FLF0\|RS92_ARATH	1E-119	40S ribosomal protein S9-2
trEMBL	tr\|W9QQ56\|W9QQ56_9ROSA	7E-131	40S ribosomal protein S9-2 {ECO:0000313\|EMBL:EXB49964.1}
TAIR10	AT5G39850.1	3E-91	Ribosomal protein S4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39623942	39625196	+
GWHAAZE00000007	mRNA	39623942	39625196	+
GWHAAZE00000007	exon	39623942	39624357	+
GWHAAZE00000007	exon	39624992	39625196	+
GWHAAZE00000007	CDS	39623942	39624357	+
GWHAAZE00000007	CDS	39624992	39625196	+

Transcript Sequence
>GWHTAAZE024333 ATACTTCTGAATGCATTATGTTTTGTGGTTTCAGATGGGAAGACTTTCAAGAAGCCTCGTCGACCCTACGAAAAGGAGCGTTTGGATGCAGAGTTGAAGCTTGTTGGAGAGTATGGACTTAGGTGTAAAAGAGAGCTGTGGAGGGTACAATATGCATTGAGTCGCATCCGTAATGCTGCAAGGATGCTTCTCACTCTAGACGAGAAGGACCCTCGTCGGATCTTTGAGGGTGAAGCCCTTCTCCGCAGGATGAACAGGTATGGGCTTCTTGATGAAAGCCAAAACAAGCTCGATTATGTCTTGGCTTTGACTGTGGAAAATTTCCTTGAACGCCGTCTTCAAACCCTTGTATTCAAGACTGGTATGGCCAAGTCAATCCACCATGCTCGTGTGCTCATCAGACAGAGGCATATCAGGGTTGGGAGGCAGGTGGTTAATGTACCATCTTTCATGGTGAGGGTGGACTCACAGAAGCACATTGATTTCTCCCTAACTAGCCCCTTTGGAGGTGGTCGTCCTGGAAGAGTCAAGCGAAGGAACCAAAAGGCTGCGGCCAAGAAAGCTGCTGGTGGTGGTGATGGTGACGAGGAAGATGAAGACTGAAGAATGATATCATTATAA

Network for GWHGAAZE024299

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00163.20	Ribosomal_S4	17	66	7.00E-07
PF01479.26	S4	111	154	1.00E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02997	RP-S9e, RPS9	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	464.048
	SRR3591706	second leaf	201.962
	SRR3591707	mature leaf	132.270
	SRR3591708	Shoot apex	566.096
	SRR3591709	Stem	268.794
	SRR3591710	White floral bud	221.282
	SRR3591711	White flower	276.606
	SRR3591712	Green floral bud	441.868
	SRR3591713	Yellow flower	262.791
SRP173429	SRR8316895	Juvenile bud stage	202.251
	SRR8316896	Juvenile bud stage	252.891
	SRR8316897	Juvenile bud stage	163.274
	SRR8316894	Third green stage	116.323
	SRR8316900	Third green stage	341.862
	SRR8316901	Third green stage	330.232
	SRR8316898	Complete white stage	56.061
	SRR8316899	Complete white stage	338.409
	SRR8316903	Complete white stage	88.246
	SRR8316902	Silver flowering stage	65.417
	SRR8316904	Silver flowering stage	63.346
	SRR8316905	Silver flowering stage	35.329
	SRR8316906	Gold flowering stage	129.285
	SRR8316907	Gold flowering stage	133.449
	SRR8316908	Gold flowering stage	150.820
SRP132670	SRR6706286	Control	335.079
	SRR6706287	Light intensity 50%	354.436
	SRR6706288	Light intensity 20%	415.129
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	394.991
	CNS0095593	Slightly white alabastrum(diploid) 2	449.257
	CNS0095594	Slightly white alabastrum(diploid) 3	340.725
	CNS0095595	Whole white alabastrum(diploid) 2	358.684
	CNS0095596	Whole white alabastrum(diploid) 3	396.681
	CNS0095597	Whole white alabastrum(diploid) 4	326.440
	CNS0095598	Silvery flower (diploied) 1	207.978
	CNS0095599	Silvery flower (diploied) 2	196.450
	CNS0095600	Silvery flower (diploied) 3	142.999
	CNS0095601	Golden flower (diploid) 1	213.501
	CNS0095602	Golden flower (diploid) 2	169.756
	CNS0095603	Golden flower (diploid) 3	169.469
	CNS0095604	Slightly white alabastrum(tetraploid) 1	367.938
	CNS0095605	Slightly white alabastrum(tetraploid) 2	389.276
	CNS0095606	Slightly white alabastrum(tetraploid) 3	480.778
	CNS0095607	Whole white alabastrum(tetraploid) 1	254.862
	CNS0095608	Whole white alabastrum(tetraploid) 2	270.620
	CNS0095609	Whole white alabastrum(tetraploid) 3	345.362
	CNS0095610	Silvery flower (tetraploid) 1	151.417
	CNS0095611	Silvery flower (tetraploid) 2	134.983
	CNS0095612	Silvery flower (tetraploid) 3	96.678
	CNS0095613	Golden flower (tetraploid) 1	112.160
	CNS0095614	Golden flower (tetraploid) 2	112.106
	CNS0095615	Golden flower (tetraploid) 3	102.240
CRA001975	CRR073297	Stem 1	405.705
	CRR073298	Stem 2	390.694
	CRR073299	Stem 3	466.484
	CRR073300	Leaf 1	458.923
	CRR073301	Leaf 2	519.336
	CRR073302	Leaf 3	547.798
	CRR073303	Juvenile bud 1	461.873
	CRR073304	Juvenile bud 2	371.227
	CRR073305	Juvenile bud 3	430.761
	CRR073306	Third green 1	53.249
	CRR073307	Third green 2	63.966
	CRR073308	Third green 3	70.101
	CRR073309	Second white 1	78.947
	CRR073310	Second white 2	54.855
	CRR073311	Second white 3	37.386
	CRR073312	Silver flowering 1	107.150
	CRR073313	Silver flowering 2	189.667
	CRR073314	Silver flowering 3	136.847
	CRR073315	Gold flowering 1	199.779
	CRR073316	Gold flowering 2	215.538
	CRR073317	Gold flowering 3	246.129
	CRR073318	Tawny withering 1	444.117
	CRR073319	Tawny withering 2	383.508
	CRR073320	Tawny withering 3	420.855