Gene detail

Detail information of GWHGAAZE024288

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAT38711.2	1.40578E-30	60S ribosomal protein L34, putative [Solanum demissum]
Swissprot	tr\|P41098\|RL34_TOBAC	3E-31	60S ribosomal protein L34
trEMBL	tr\|Q6L3T8\|Q6L3T8_SOLDE	5E-31	60S ribosomal protein L34, putative {ECO:0000313\|EMBL:AAT38711.2}
TAIR10	AT1G26880.1	9E-24	Ribosomal protein L34e superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39501422	39502520	+
GWHAAZE00000007	mRNA	39501422	39502520	+
GWHAAZE00000007	exon	39501422	39501514	+
GWHAAZE00000007	exon	39502129	39502520	+
GWHAAZE00000007	five_prime_UTR	39501422	39501435	+
GWHAAZE00000007	CDS	39501436	39501514	+
GWHAAZE00000007	CDS	39502129	39502265	+
GWHAAZE00000007	three_prime_UTR	39502266	39502520	+

Transcript Sequence
>GWHTAAZE024322 TTGAAGCACAAAAAATGGTGCAAAGGTTAACATATCGTAAGAGGCATAGTTATGCCACCAAATCCAACCAGAACAGGGTCGTCAAAACCCCCGGTGGGAAGCTAGTTTACCAAACTACCAAGAAGAGAGCTAGCGGACCTAAATGTCCCGTCACTGGGAAGAGAATCCAAGGGGTATTTATTCCTTTTTCATTGTTAAATGATAGGATTCCACATATTTTTCTTTTCTAAGCATTTGATATTAGATTTTTTTTTATTTTCTATAAGCTTGTAGTTGTAAAACTATTTCTATTTGAATGTGTAATTTGGATAATTTTAGGTAGATTTTGGCTGATCTTAGGTTTGTGAAAACGCAATACTGGTTTGTTTTCTACCAAATGAAGCTTGAAGCCATCATATCTGGTTCATAGTTGACTAGTATAGATAAGATTGAGTTTTTGATTTTCACTTTATTTTTTCCAACTTCTTGACCTGATTCTGTAAATT

Network for GWHGAAZE024288

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01199.19	Ribosomal_L34e	1	54	2.00E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02915	RP-L34e, RPL34	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	250.740
	SRR3591706	second leaf	102.464
	SRR3591707	mature leaf	52.965
	SRR3591708	Shoot apex	287.205
	SRR3591709	Stem	149.978
	SRR3591710	White floral bud	142.136
	SRR3591711	White flower	121.007
	SRR3591712	Green floral bud	216.158
	SRR3591713	Yellow flower	89.804
SRP173429	SRR8316895	Juvenile bud stage	71.323
	SRR8316896	Juvenile bud stage	96.527
	SRR8316897	Juvenile bud stage	72.938
	SRR8316894	Third green stage	46.575
	SRR8316900	Third green stage	135.412
	SRR8316901	Third green stage	139.413
	SRR8316898	Complete white stage	33.324
	SRR8316899	Complete white stage	156.594
	SRR8316903	Complete white stage	61.485
	SRR8316902	Silver flowering stage	29.996
	SRR8316904	Silver flowering stage	34.407
	SRR8316905	Silver flowering stage	18.284
	SRR8316906	Gold flowering stage	60.431
	SRR8316907	Gold flowering stage	64.259
	SRR8316908	Gold flowering stage	93.369
SRP132670	SRR6706286	Control	269.580
	SRR6706287	Light intensity 50%	278.056
	SRR6706288	Light intensity 20%	298.097
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	125.960
	CNS0095593	Slightly white alabastrum(diploid) 2	144.989
	CNS0095594	Slightly white alabastrum(diploid) 3	114.753
	CNS0095595	Whole white alabastrum(diploid) 2	95.721
	CNS0095596	Whole white alabastrum(diploid) 3	103.354
	CNS0095597	Whole white alabastrum(diploid) 4	74.263
	CNS0095598	Silvery flower (diploied) 1	72.575
	CNS0095599	Silvery flower (diploied) 2	61.520
	CNS0095600	Silvery flower (diploied) 3	57.269
	CNS0095601	Golden flower (diploid) 1	68.801
	CNS0095602	Golden flower (diploid) 2	47.458
	CNS0095603	Golden flower (diploid) 3	52.284
	CNS0095604	Slightly white alabastrum(tetraploid) 1	168.076
	CNS0095605	Slightly white alabastrum(tetraploid) 2	155.211
	CNS0095606	Slightly white alabastrum(tetraploid) 3	305.814
	CNS0095607	Whole white alabastrum(tetraploid) 1	87.871
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.025
	CNS0095609	Whole white alabastrum(tetraploid) 3	242.161
	CNS0095610	Silvery flower (tetraploid) 1	109.197
	CNS0095611	Silvery flower (tetraploid) 2	58.192
	CNS0095612	Silvery flower (tetraploid) 3	45.687
	CNS0095613	Golden flower (tetraploid) 1	48.879
	CNS0095614	Golden flower (tetraploid) 2	81.353
	CNS0095615	Golden flower (tetraploid) 3	28.271
CRA001975	CRR073297	Stem 1	148.095
	CRR073298	Stem 2	168.477
	CRR073299	Stem 3	148.537
	CRR073300	Leaf 1	181.814
	CRR073301	Leaf 2	178.896
	CRR073302	Leaf 3	141.662
	CRR073303	Juvenile bud 1	98.995
	CRR073304	Juvenile bud 2	97.026
	CRR073305	Juvenile bud 3	64.219
	CRR073306	Third green 1	26.400
	CRR073307	Third green 2	25.911
	CRR073308	Third green 3	29.777
	CRR073309	Second white 1	12.056
	CRR073310	Second white 2	14.404
	CRR073311	Second white 3	12.009
	CRR073312	Silver flowering 1	15.210
	CRR073313	Silver flowering 2	13.201
	CRR073314	Silver flowering 3	16.858
	CRR073315	Gold flowering 1	34.805
	CRR073316	Gold flowering 2	51.850
	CRR073317	Gold flowering 3	37.484
	CRR073318	Tawny withering 1	126.763
	CRR073319	Tawny withering 2	68.990
	CRR073320	Tawny withering 3	111.286