Gene detail

Detail information of GWHGAAZE024222

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007199850.1	1.16438E-28	hypothetical protein PRUPE_ppa005660mg [Prunus persica]
Swissprot	tr\|Q9SB58\|ZDH19_ARATH	5E-30	Protein S-acyltransferase 8
trEMBL	tr\|M5VIZ6\|M5VIZ6_PRUPE	4E-29	S-acyltransferase {ECO:0000256\|RuleBase:RU079119}
TAIR10	AT4G24630.1	1E-24	DHHC-type zinc finger family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	37824334	37829301	-
GWHAAZE00000007	mRNA	37824334	37829301	-
GWHAAZE00000007	exon	37829243	37829301	-
GWHAAZE00000007	exon	37825386	37825479	-
GWHAAZE00000007	exon	37824334	37824573	-
GWHAAZE00000007	CDS	37829243	37829301	-
GWHAAZE00000007	CDS	37825386	37825479	-
GWHAAZE00000007	CDS	37824334	37824573	-

Transcript Sequence
>GWHTAAZE024256 ATGTATGCTTTTATCTTCAATCAAGGATTCTTTGATTGGGTTCGCATTGGAAGAGCTCGGTCATGCGTCCCCAAGGCTGATCACTTGATTTTTTCTTTATCCTCTCATTCAAGTCCCTTCTTTGATCCAAGAACTGTTCATAGTGAACAGGGAAAATTCTTTCTCGGTGGGAGGTTGATATTTGGGCCGGACGCTAGGTCATTGTTTGGCACACTGATTCTGATCATTCTTCCTGTTGTTATCTTTTGTATATTTGTTGGAAGACATCTTCGCCACAAGTTTTCCTCATATAATGCTGGATATGCAATTCTGGTGGTAGCAATTGTCTTCACAATCTATGTTAGTCTTCTTAAGCTTTTACTTGACACTTCTAGTGATGAAACTGCTATGTGA

Network for GWHGAAZE024222

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16675	ZDHHC9_14_18	Hippo signaling pathway - fly	map04391

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.685
	SRR3591706	second leaf	8.424
	SRR3591707	mature leaf	8.553
	SRR3591708	Shoot apex	9.269
	SRR3591709	Stem	12.996
	SRR3591710	White floral bud	17.283
	SRR3591711	White flower	20.982
	SRR3591712	Green floral bud	11.049
	SRR3591713	Yellow flower	17.336
SRP173429	SRR8316895	Juvenile bud stage	6.506
	SRR8316896	Juvenile bud stage	6.705
	SRR8316897	Juvenile bud stage	3.175
	SRR8316894	Third green stage	2.760
	SRR8316900	Third green stage	9.396
	SRR8316901	Third green stage	7.810
	SRR8316898	Complete white stage	7.610
	SRR8316899	Complete white stage	13.037
	SRR8316903	Complete white stage	10.217
	SRR8316902	Silver flowering stage	6.666
	SRR8316904	Silver flowering stage	13.287
	SRR8316905	Silver flowering stage	4.082
	SRR8316906	Gold flowering stage	15.773
	SRR8316907	Gold flowering stage	16.485
	SRR8316908	Gold flowering stage	15.541
SRP132670	SRR6706286	Control	7.589
	SRR6706287	Light intensity 50%	8.145
	SRR6706288	Light intensity 20%	8.093
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.448
	CNS0095593	Slightly white alabastrum(diploid) 2	4.237
	CNS0095594	Slightly white alabastrum(diploid) 3	4.013
	CNS0095595	Whole white alabastrum(diploid) 2	5.091
	CNS0095596	Whole white alabastrum(diploid) 3	4.874
	CNS0095597	Whole white alabastrum(diploid) 4	3.062
	CNS0095598	Silvery flower (diploied) 1	7.576
	CNS0095599	Silvery flower (diploied) 2	5.538
	CNS0095600	Silvery flower (diploied) 3	17.545
	CNS0095601	Golden flower (diploid) 1	5.225
	CNS0095602	Golden flower (diploid) 2	14.434
	CNS0095603	Golden flower (diploid) 3	16.099
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.830
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.180
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.997
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.916
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.596
	CNS0095610	Silvery flower (tetraploid) 1	17.083
	CNS0095611	Silvery flower (tetraploid) 2	17.461
	CNS0095612	Silvery flower (tetraploid) 3	16.485
	CNS0095613	Golden flower (tetraploid) 1	13.845
	CNS0095614	Golden flower (tetraploid) 2	16.983
	CNS0095615	Golden flower (tetraploid) 3	31.847
CRA001975	CRR073297	Stem 1	4.217
	CRR073298	Stem 2	4.311
	CRR073299	Stem 3	6.354
	CRR073300	Leaf 1	4.313
	CRR073301	Leaf 2	3.477
	CRR073302	Leaf 3	3.945
	CRR073303	Juvenile bud 1	4.144
	CRR073304	Juvenile bud 2	4.954
	CRR073305	Juvenile bud 3	5.208
	CRR073306	Third green 1	4.483
	CRR073307	Third green 2	3.549
	CRR073308	Third green 3	5.247
	CRR073309	Second white 1	9.662
	CRR073310	Second white 2	7.308
	CRR073311	Second white 3	10.931
	CRR073312	Silver flowering 1	10.827
	CRR073313	Silver flowering 2	13.815
	CRR073314	Silver flowering 3	12.241
	CRR073315	Gold flowering 1	1.900
	CRR073316	Gold flowering 2	3.539
	CRR073317	Gold flowering 3	4.281
	CRR073318	Tawny withering 1	3.870
	CRR073319	Tawny withering 2	3.767
	CRR073320	Tawny withering 3	5.242