Gene detail

Detail information of GWHGAAZE024111

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008444197.1	4.19232E-46	PREDICTED: 1-aminocyclopropane-1-carboxylate oxidase 5 [Cucumis melo]
Swissprot	tr\|Q0WPW4\|ACCO5_ARATH	2E-34	1-aminocyclopropane-1-carboxylate oxidase 5
trEMBL	tr\|A0A0A0L1U8\|A0A0A0L1U8_CUCSA	2E-46	Uncharacterized protein {ECO:0000313\|EMBL:KGN54542.1}
TAIR10	AT1G77330.1	7E-29	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	35001064	35001357	+
GWHAAZE00000007	mRNA	35001064	35001357	+
GWHAAZE00000007	exon	35001064	35001357	+
GWHAAZE00000007	CDS	35001064	35001357	+

Transcript Sequence
>GWHTAAZE024145 ATGCAATTGTCATCAACACTGGTGACCAAATTCGAGGTTTTGAGCAATGGGCGGTACAAGAGTGTTTGGCACCGAGTTTTGGCTCTGCCGGATGGGAATAGGAGATCAGTGGCCTCGTTTTATAACCCGTCGTTTAAGGCTACCATAGCTCCAGCAGCAGAACTTATTACGGAAGTGAACAAGGAGGTGGAACAAGGTTATCCCGAGTTTGTGTTTGGCAACTACATGTCTGTGTATGCCGAACAAAAGTTTCTCCCCAAGGAACCAAGGTTCCAAGCTGTCAGGGCCATGTAA

Network for GWHGAAZE024111

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03171.21	2OG-FeII_Oxy	11	43	0.00025

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05933	E1.14.17.4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Cysteine and methionine metabolism	map00270

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.685
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.901
	SRR3591711	White flower	1.497
	SRR3591712	Green floral bud	0.561
	SRR3591713	Yellow flower	3.156
SRP173429	SRR8316895	Juvenile bud stage	0.636
	SRR8316896	Juvenile bud stage	1.185
	SRR8316897	Juvenile bud stage	0.384
	SRR8316894	Third green stage	0.334
	SRR8316900	Third green stage	0.125
	SRR8316901	Third green stage	0.893
	SRR8316898	Complete white stage	3.238
	SRR8316899	Complete white stage	0.373
	SRR8316903	Complete white stage	3.325
	SRR8316902	Silver flowering stage	3.429
	SRR8316904	Silver flowering stage	4.382
	SRR8316905	Silver flowering stage	2.118
	SRR8316906	Gold flowering stage	5.458
	SRR8316907	Gold flowering stage	6.654
	SRR8316908	Gold flowering stage	5.425
SRP132670	SRR6706286	Control	0.457
	SRR6706287	Light intensity 50%	0.602
	SRR6706288	Light intensity 20%	0.589
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.682
	CNS0095593	Slightly white alabastrum(diploid) 2	0.252
	CNS0095594	Slightly white alabastrum(diploid) 3	0.125
	CNS0095595	Whole white alabastrum(diploid) 2	0.627
	CNS0095596	Whole white alabastrum(diploid) 3	0.195
	CNS0095597	Whole white alabastrum(diploid) 4	1.202
	CNS0095598	Silvery flower (diploied) 1	2.538
	CNS0095599	Silvery flower (diploied) 2	0.353
	CNS0095600	Silvery flower (diploied) 3	2.273
	CNS0095601	Golden flower (diploid) 1	1.239
	CNS0095602	Golden flower (diploid) 2	3.251
	CNS0095603	Golden flower (diploid) 3	3.715
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.292
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.446
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.651
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.469
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.390
	CNS0095610	Silvery flower (tetraploid) 1	4.290
	CNS0095611	Silvery flower (tetraploid) 2	4.373
	CNS0095612	Silvery flower (tetraploid) 3	7.288
	CNS0095613	Golden flower (tetraploid) 1	8.156
	CNS0095614	Golden flower (tetraploid) 2	5.309
	CNS0095615	Golden flower (tetraploid) 3	13.635
CRA001975	CRR073297	Stem 1	0.627
	CRR073298	Stem 2	0.651
	CRR073299	Stem 3	0.405
	CRR073300	Leaf 1	0.164
	CRR073301	Leaf 2	0.752
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.471
	CRR073307	Third green 2	0.402
	CRR073308	Third green 3	0.364
	CRR073309	Second white 1	0.851
	CRR073310	Second white 2	0.636
	CRR073311	Second white 3	1.586
	CRR073312	Silver flowering 1	0.502
	CRR073313	Silver flowering 2	0.686
	CRR073314	Silver flowering 3	1.205
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.092
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000