Gene detail

Detail information of GWHGAAZE024094

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010664174.1	3.57841E-84	PREDICTED: protein translocase subunit SECA2, chloroplastic isoform X1 [Vitis vinifera]
Swissprot	tr\|D8WUA4\|SECA2_ARATH	8E-70	Protein translocase subunit SECA2, chloroplastic (Precursor)
trEMBL	tr\|F6H0I5\|F6H0I5_VITVI	1E-84	Protein translocase subunit SecA {ECO:0000256\|RuleBase:RU003874}
TAIR10	AT1G21650.2	7E-61	Preprotein translocase SecA family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	34760308	34761825	-
GWHAAZE00000007	mRNA	34760308	34761825	-
GWHAAZE00000007	exon	34760308	34760469	-
GWHAAZE00000007	exon	34761377	34761500	-
GWHAAZE00000007	exon	34761614	34761825	-
GWHAAZE00000007	CDS	34761614	34761825	-
GWHAAZE00000007	CDS	34761377	34761500	-
GWHAAZE00000007	CDS	34760308	34760469	-

Transcript Sequence
>GWHTAAZE024128 ATGTTCATTGGAATTTTTCCAGACTCATCTGTATGGATTACGGAGGAAGCCCTAATGAAATCGCTTGACCAACTTCATGAATTAAGTAGTGTAAATATAAACAACTTTCACCTTCCAAATTTGCCGGCTCCTCCAAATACCTTCAGAGGTATCCGCAGGAAGAGTTCTTCATTGAAACGTTGGCTTGACATATGTTCCGATGATTCAGCTAAAGATGGAAGGTACAGAGCAACCGCTAATCTTCTCCGCAAGTATCTTGGAGATTTTTTAATTGCTTCATATTTGGAGGTCATACAAGAATCTGGTTATGATGATGGATATGTTAAGGAAATAGAGGTCAATGTGAGGAGTTTCGGGCACAGAAATCCACTTGAGGAGTACAAAATAGATGGTTGCCGATTTTTCATCTCCATGCTCAGTGCCACTCGGAGGCAAACTGTGGAGTCACTCTTGCGGCATTGGTCATCTTCCATGGAGTCCCAAGAAATATATGTATAA

Network for GWHGAAZE024094

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07516.14	SecA_SW	112	152	2.90E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03070	secA	Protein export	map03060
		Bacterial secretion system	map03070
		Quorum sensing	map02024

Gene Ontology

GO term	Ontology	Name
GO:0017038	biological_process	protein import
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.465
	SRR3591706	second leaf	1.141
	SRR3591707	mature leaf	3.144
	SRR3591708	Shoot apex	2.869
	SRR3591709	Stem	2.247
	SRR3591710	White floral bud	1.080
	SRR3591711	White flower	2.316
	SRR3591712	Green floral bud	1.708
	SRR3591713	Yellow flower	2.181
SRP173429	SRR8316895	Juvenile bud stage	1.873
	SRR8316896	Juvenile bud stage	2.701
	SRR8316897	Juvenile bud stage	1.823
	SRR8316894	Third green stage	0.765
	SRR8316900	Third green stage	3.074
	SRR8316901	Third green stage	2.473
	SRR8316898	Complete white stage	0.374
	SRR8316899	Complete white stage	2.632
	SRR8316903	Complete white stage	0.809
	SRR8316902	Silver flowering stage	1.229
	SRR8316904	Silver flowering stage	1.991
	SRR8316905	Silver flowering stage	0.611
	SRR8316906	Gold flowering stage	1.842
	SRR8316907	Gold flowering stage	3.015
	SRR8316908	Gold flowering stage	2.284
SRP132670	SRR6706286	Control	0.810
	SRR6706287	Light intensity 50%	1.115
	SRR6706288	Light intensity 20%	0.969
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.556
	CNS0095593	Slightly white alabastrum(diploid) 2	2.678
	CNS0095594	Slightly white alabastrum(diploid) 3	1.824
	CNS0095595	Whole white alabastrum(diploid) 2	0.790
	CNS0095596	Whole white alabastrum(diploid) 3	1.246
	CNS0095597	Whole white alabastrum(diploid) 4	1.058
	CNS0095598	Silvery flower (diploied) 1	2.911
	CNS0095599	Silvery flower (diploied) 2	0.955
	CNS0095600	Silvery flower (diploied) 3	1.602
	CNS0095601	Golden flower (diploid) 1	1.968
	CNS0095602	Golden flower (diploid) 2	1.407
	CNS0095603	Golden flower (diploid) 3	1.425
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.971
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.925
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.929
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.076
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.972
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.274
	CNS0095610	Silvery flower (tetraploid) 1	2.400
	CNS0095611	Silvery flower (tetraploid) 2	1.458
	CNS0095612	Silvery flower (tetraploid) 3	2.485
	CNS0095613	Golden flower (tetraploid) 1	1.674
	CNS0095614	Golden flower (tetraploid) 2	1.745
	CNS0095615	Golden flower (tetraploid) 3	1.464
CRA001975	CRR073297	Stem 1	0.777
	CRR073298	Stem 2	1.962
	CRR073299	Stem 3	1.366
	CRR073300	Leaf 1	2.524
	CRR073301	Leaf 2	1.386
	CRR073302	Leaf 3	0.788
	CRR073303	Juvenile bud 1	1.418
	CRR073304	Juvenile bud 2	0.606
	CRR073305	Juvenile bud 3	0.580
	CRR073306	Third green 1	0.135
	CRR073307	Third green 2	0.125
	CRR073308	Third green 3	0.126
	CRR073309	Second white 1	0.239
	CRR073310	Second white 2	0.278
	CRR073311	Second white 3	0.417
	CRR073312	Silver flowering 1	0.354
	CRR073313	Silver flowering 2	0.685
	CRR073314	Silver flowering 3	0.339
	CRR073315	Gold flowering 1	1.346
	CRR073316	Gold flowering 2	3.231
	CRR073317	Gold flowering 3	0.501
	CRR073318	Tawny withering 1	0.450
	CRR073319	Tawny withering 2	1.226
	CRR073320	Tawny withering 3	1.925