Gene detail

Detail information of GWHGAAZE024072

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN35506.1	3.5007E-55	Protein disulfide-isomerase [Glycine soja]
COG	YP_003524820.1	4E-17	thioredoxin
Swissprot	tr\|Q9XF61\|PDI_DATGL	1E-52	Protein disulfide-isomerase (Precursor)
trEMBL	tr\|I1JZ43\|I1JZ43_SOYBN	2E-56	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA04G42690.3}
TAIR10	AT1G21750.2	3E-43	PDI-like 1-1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	34313042	34315278	-
GWHAAZE00000007	mRNA	34313042	34315278	-
GWHAAZE00000007	exon	34313042	34313076	-
GWHAAZE00000007	exon	34313440	34313659	-
GWHAAZE00000007	exon	34313772	34313802	-
GWHAAZE00000007	exon	34315100	34315278	-
GWHAAZE00000007	CDS	34315100	34315278	-
GWHAAZE00000007	CDS	34313772	34313802	-
GWHAAZE00000007	CDS	34313440	34313659	-
GWHAAZE00000007	CDS	34313042	34313076	-

Transcript Sequence
>GWHTAAZE024106 ATGAGATCTAGAGTTTGGATCATCGTATTATTAGTTATATCAGTGATCTCATCCTATATTAGAGAGATTTCAGCTTCCGATAGCGAATCGAAGGGATTCGTAGTTGGTCTCGATCACTCCAACTTCCACGAAACCATCACCAAACACGATTTCATCGTCGTCGAGTTTTACGCTCCATGGTGCGGCTACTGTAGGAGACTTGCTCCAGAGTACGCCAAAGCTGCATCAATATTGAATCATAACGATCCTCCCATAATTCTCGCAAAAATTGATGCGACTGATGCAAAAAACAGAGTTCTTAAGAAAGAATTCGACATCAAGGGTTACCCGACAATTAAGATCTTTAAAAACGGAGGGCAGAACGTCGAGGACTATGAAGGAAGTCGAGATGCTGATGGTATTGTTGCTTATTTGAAGAAACAATTAGTAGGACAAACTGTCTTTGAGAAATTGTTGGAACTTTGA

Network for GWHGAAZE024072

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	35	140	2.90E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09580	PDIA1, P4HB	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0016853	molecular_function	isomerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.165
	SRR3591706	second leaf	1.628
	SRR3591707	mature leaf	0.936
	SRR3591708	Shoot apex	3.688
	SRR3591709	Stem	2.930
	SRR3591710	White floral bud	2.446
	SRR3591711	White flower	3.119
	SRR3591712	Green floral bud	16.078
	SRR3591713	Yellow flower	3.608
SRP173429	SRR8316895	Juvenile bud stage	0.929
	SRR8316896	Juvenile bud stage	2.185
	SRR8316897	Juvenile bud stage	3.482
	SRR8316894	Third green stage	0.694
	SRR8316900	Third green stage	2.709
	SRR8316901	Third green stage	2.208
	SRR8316898	Complete white stage	0.124
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.021
	SRR8316902	Silver flowering stage	0.562
	SRR8316904	Silver flowering stage	1.221
	SRR8316905	Silver flowering stage	0.693
	SRR8316906	Gold flowering stage	1.362
	SRR8316907	Gold flowering stage	0.501
	SRR8316908	Gold flowering stage	1.480
SRP132670	SRR6706286	Control	1.935
	SRR6706287	Light intensity 50%	2.574
	SRR6706288	Light intensity 20%	1.784
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.678
	CNS0095593	Slightly white alabastrum(diploid) 2	1.888
	CNS0095594	Slightly white alabastrum(diploid) 3	1.820
	CNS0095595	Whole white alabastrum(diploid) 2	1.731
	CNS0095596	Whole white alabastrum(diploid) 3	2.250
	CNS0095597	Whole white alabastrum(diploid) 4	2.185
	CNS0095598	Silvery flower (diploied) 1	0.644
	CNS0095599	Silvery flower (diploied) 2	0.318
	CNS0095600	Silvery flower (diploied) 3	1.477
	CNS0095601	Golden flower (diploid) 1	0.731
	CNS0095602	Golden flower (diploid) 2	2.576
	CNS0095603	Golden flower (diploid) 3	1.529
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.372
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.977
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.347
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.981
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.684
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.533
	CNS0095610	Silvery flower (tetraploid) 1	2.936
	CNS0095611	Silvery flower (tetraploid) 2	2.448
	CNS0095612	Silvery flower (tetraploid) 3	2.314
	CNS0095613	Golden flower (tetraploid) 1	1.951
	CNS0095614	Golden flower (tetraploid) 2	1.044
	CNS0095615	Golden flower (tetraploid) 3	1.349
CRA001975	CRR073297	Stem 1	2.909
	CRR073298	Stem 2	1.925
	CRR073299	Stem 3	1.182
	CRR073300	Leaf 1	1.419
	CRR073301	Leaf 2	1.266
	CRR073302	Leaf 3	2.400
	CRR073303	Juvenile bud 1	0.426
	CRR073304	Juvenile bud 2	1.239
	CRR073305	Juvenile bud 3	0.123
	CRR073306	Third green 1	0.132
	CRR073307	Third green 2	1.872
	CRR073308	Third green 3	0.810
	CRR073309	Second white 1	1.113
	CRR073310	Second white 2	1.320
	CRR073311	Second white 3	0.536
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.326
	CRR073315	Gold flowering 1	0.402
	CRR073316	Gold flowering 2	0.694
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.869
	CRR073319	Tawny withering 2	0.325
	CRR073320	Tawny withering 3	2.410