Gene detail

Detail information of GWHGAAZE023862

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009597365.1	1.8782E-101	PREDICTED: serine/threonine-protein kinase-like protein CCR4 [Nicotiana tomentosiformis]
COG	YP_001958461.1	6E-17	hypothetical protein Aasi_1443
Swissprot	tr\|Q9FIJ6\|ACCR4_ARATH	7E-74	Serine/threonine-protein kinase-like protein CCR4 (Precursor)
trEMBL	tr\|Q9FUK3\|Q9FUK3_TOBAC	7E-99	Cytokinin-regulated kinase 1 {ECO:0000313\|EMBL:AAG25966.1}
TAIR10	AT5G47850.1	9E-57	CRINKLY4 related 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	28406745	28407338	+
GWHAAZE00000007	mRNA	28406745	28407338	+
GWHAAZE00000007	exon	28406745	28406898	+
GWHAAZE00000007	exon	28406929	28407338	+
GWHAAZE00000007	CDS	28406745	28406898	+
GWHAAZE00000007	CDS	28406929	28407338	+

Transcript Sequence
>GWHTAAZE023892 ATGGGCAATGGGAGTCACTTGGAAGAGTTCTCCTTTGAAATGCTGCTTCAAGCGACCGACAATTTCTCCAACCAGCACAAGATTGGTTCCGGAAGCTTTGGTTCCGTGTACCATGCCACACTAGATGACGGCCGCCAGGTGGCTGTCAAACGGGGCCCCACAAAGCGCCAAGAAGACATGGACAATGCCTTCCTCAATGAGCTCGAGTTTTTATCTAATCTCAACCACAAGAACCTTGTTCGTTTATTAGGGTATTGCGAAGATAGAAACGAGCTCATATTAGTCTACGAGTACCTAACCAACGGTAGCCTCCATGACCATCTCCATAAGCTCAAATCCTCACCATTGATGCATTGGAGTGAACGCATTAGGGTGGCCCTAGATGCAGCAAGAGGAATCGAGTACCTACATGAGTATGCGGTTCCTCAAATCATACACCGGGACATCAAGTCAAGCAACATATTGCTTGATGCCACATGGACCGCCAAGGTGTCTGATTTTGGACTTTCCTTGATGGGGCCCAAGGATGATGAGTCGCACCTTTCCTTGCATGCGGCAGGCACG

Network for GWHGAAZE023862

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	24	178	3.10E-37

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CR4L

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.305
	SRR3591706	second leaf	10.164
	SRR3591707	mature leaf	4.623
	SRR3591708	Shoot apex	9.260
	SRR3591709	Stem	38.883
	SRR3591710	White floral bud	35.216
	SRR3591711	White flower	60.274
	SRR3591712	Green floral bud	20.320
	SRR3591713	Yellow flower	18.395
SRP173429	SRR8316895	Juvenile bud stage	48.877
	SRR8316896	Juvenile bud stage	9.348
	SRR8316897	Juvenile bud stage	25.662
	SRR8316894	Third green stage	14.841
	SRR8316900	Third green stage	12.571
	SRR8316901	Third green stage	19.920
	SRR8316898	Complete white stage	0.821
	SRR8316899	Complete white stage	54.025
	SRR8316903	Complete white stage	1.154
	SRR8316902	Silver flowering stage	1.440
	SRR8316904	Silver flowering stage	2.615
	SRR8316905	Silver flowering stage	1.748
	SRR8316906	Gold flowering stage	10.278
	SRR8316907	Gold flowering stage	15.324
	SRR8316908	Gold flowering stage	12.513
SRP132670	SRR6706286	Control	3.029
	SRR6706287	Light intensity 50%	4.994
	SRR6706288	Light intensity 20%	3.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.862
	CNS0095593	Slightly white alabastrum(diploid) 2	38.104
	CNS0095594	Slightly white alabastrum(diploid) 3	27.024
	CNS0095595	Whole white alabastrum(diploid) 2	10.804
	CNS0095596	Whole white alabastrum(diploid) 3	2.613
	CNS0095597	Whole white alabastrum(diploid) 4	12.289
	CNS0095598	Silvery flower (diploied) 1	109.408
	CNS0095599	Silvery flower (diploied) 2	77.252
	CNS0095600	Silvery flower (diploied) 3	25.726
	CNS0095601	Golden flower (diploid) 1	105.861
	CNS0095602	Golden flower (diploid) 2	63.519
	CNS0095603	Golden flower (diploid) 3	59.808
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.474
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.170
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.248
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.509
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.298
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.965
	CNS0095610	Silvery flower (tetraploid) 1	3.187
	CNS0095611	Silvery flower (tetraploid) 2	1.846
	CNS0095612	Silvery flower (tetraploid) 3	9.245
	CNS0095613	Golden flower (tetraploid) 1	1.512
	CNS0095614	Golden flower (tetraploid) 2	1.449
	CNS0095615	Golden flower (tetraploid) 3	1.074
CRA001975	CRR073297	Stem 1	20.971
	CRR073298	Stem 2	30.156
	CRR073299	Stem 3	45.936
	CRR073300	Leaf 1	64.006
	CRR073301	Leaf 2	88.525
	CRR073302	Leaf 3	51.059
	CRR073303	Juvenile bud 1	72.642
	CRR073304	Juvenile bud 2	81.604
	CRR073305	Juvenile bud 3	158.059
	CRR073306	Third green 1	12.718
	CRR073307	Third green 2	9.431
	CRR073308	Third green 3	11.284
	CRR073309	Second white 1	10.797
	CRR073310	Second white 2	8.964
	CRR073311	Second white 3	9.506
	CRR073312	Silver flowering 1	72.146
	CRR073313	Silver flowering 2	55.222
	CRR073314	Silver flowering 3	21.511
	CRR073315	Gold flowering 1	30.049
	CRR073316	Gold flowering 2	49.011
	CRR073317	Gold flowering 3	77.462
	CRR073318	Tawny withering 1	23.371
	CRR073319	Tawny withering 2	69.590
	CRR073320	Tawny withering 3	25.915