Gene detail

Detail information of GWHGAAZE023764

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004248259.1	1.07334E-81	PREDICTED: probable phenylalanine--tRNA ligase alpha subunit [Solanum lycopersicum]
COG	YP_687290.1	1E-40	phenylalanyl-tRNA synthetase subunit alpha
Swissprot	tr\|Q9T034\|SYFA_ARATH	1E-80	Probable phenylalanine--tRNA ligase alpha subunit
trEMBL	tr\|M1CC91\|M1CC91_SOLTU	1E-82	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400064372}
TAIR10	AT4G39280.2	7E-67	phenylalanyl-tRNA synthetase, putative / phenylalanine--tRNA ligase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	25304475	25310429	+
GWHAAZE00000007	mRNA	25304475	25310429	+
GWHAAZE00000007	exon	25304475	25304567	+
GWHAAZE00000007	exon	25308793	25308889	+
GWHAAZE00000007	exon	25309707	25309778	+
GWHAAZE00000007	exon	25310132	25310198	+
GWHAAZE00000007	exon	25310286	25310429	+
GWHAAZE00000007	five_prime_UTR	25304475	25304546	+
GWHAAZE00000007	CDS	25304547	25304567	+
GWHAAZE00000007	CDS	25308793	25308889	+
GWHAAZE00000007	CDS	25309707	25309778	+
GWHAAZE00000007	CDS	25310132	25310198	+
GWHAAZE00000007	CDS	25310286	25310415	+
GWHAAZE00000007	three_prime_UTR	25310416	25310429	+

Transcript Sequence
>GWHTAAZE023794 GCATATGATTGGAAAAGAGAGGAAGCAAACAAAAATCTCCTGAGAACTCATACCACTGCTGTTTCCTCGAGGATGCTGTACTCGCTTGCTCAGAAATCTTTTGCTGCCAAAAAGTACTACTCTGTAGATCGCGTGTTCAGAAATGAAGCTGTGGATCGAACACATCTTGCAGAGTTTCATCAAATAGAAGGACTAATATGTGATCGGGGCCTTACCCTTGGCGATCTGCAGGGAGTTCTGTATGACTTCTTCTCCCGTCTCGGTATGTCTAAGTTGCGTTTCAAGCCTGCCTACAACCCATACACTGAACCCAGCATGGAAATATTTGGTTATCATGAAGGTTTTAAGAAATGGGTTGAAATAGGAAATTCTGGAATGTTTAGACCTGAAATGCTTCTCCCAATGGGACTTCCGGAAGATGTACGTGTTATTGCCTGGGGTCTTTCCCTTGAAAGGTAACAATAAGTTGTTAC

Network for GWHGAAZE023764

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01409.21	tRNA-synt_2d	4	128	8.70E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01889	FARSA, pheS	Aminoacyl-tRNA biosynthesis	map00970

Gene Ontology

GO term	Ontology	Name
GO:0043039	biological_process	tRNA aminoacylation
GO:0000049	molecular_function	tRNA binding
GO:0004812	molecular_function	aminoacyl-tRNA ligase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.372
	SRR3591706	second leaf	13.331
	SRR3591707	mature leaf	10.742
	SRR3591708	Shoot apex	29.017
	SRR3591709	Stem	25.827
	SRR3591710	White floral bud	18.744
	SRR3591711	White flower	31.699
	SRR3591712	Green floral bud	31.092
	SRR3591713	Yellow flower	19.012
SRP173429	SRR8316895	Juvenile bud stage	15.834
	SRR8316896	Juvenile bud stage	20.838
	SRR8316897	Juvenile bud stage	18.684
	SRR8316894	Third green stage	7.210
	SRR8316900	Third green stage	17.508
	SRR8316901	Third green stage	17.548
	SRR8316898	Complete white stage	3.253
	SRR8316899	Complete white stage	17.099
	SRR8316903	Complete white stage	5.433
	SRR8316902	Silver flowering stage	2.949
	SRR8316904	Silver flowering stage	4.041
	SRR8316905	Silver flowering stage	0.977
	SRR8316906	Gold flowering stage	5.146
	SRR8316907	Gold flowering stage	7.904
	SRR8316908	Gold flowering stage	11.902
SRP132670	SRR6706286	Control	11.489
	SRR6706287	Light intensity 50%	10.869
	SRR6706288	Light intensity 20%	14.078
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.251
	CNS0095593	Slightly white alabastrum(diploid) 2	16.485
	CNS0095594	Slightly white alabastrum(diploid) 3	15.548
	CNS0095595	Whole white alabastrum(diploid) 2	16.364
	CNS0095596	Whole white alabastrum(diploid) 3	19.849
	CNS0095597	Whole white alabastrum(diploid) 4	15.277
	CNS0095598	Silvery flower (diploied) 1	10.815
	CNS0095599	Silvery flower (diploied) 2	14.489
	CNS0095600	Silvery flower (diploied) 3	11.969
	CNS0095601	Golden flower (diploid) 1	14.538
	CNS0095602	Golden flower (diploid) 2	12.321
	CNS0095603	Golden flower (diploid) 3	11.252
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.308
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.296
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.527
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.723
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.801
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.036
	CNS0095610	Silvery flower (tetraploid) 1	12.007
	CNS0095611	Silvery flower (tetraploid) 2	22.788
	CNS0095612	Silvery flower (tetraploid) 3	18.025
	CNS0095613	Golden flower (tetraploid) 1	7.682
	CNS0095614	Golden flower (tetraploid) 2	13.917
	CNS0095615	Golden flower (tetraploid) 3	4.902
CRA001975	CRR073297	Stem 1	16.309
	CRR073298	Stem 2	21.089
	CRR073299	Stem 3	15.416
	CRR073300	Leaf 1	18.888
	CRR073301	Leaf 2	22.694
	CRR073302	Leaf 3	18.122
	CRR073303	Juvenile bud 1	21.984
	CRR073304	Juvenile bud 2	12.550
	CRR073305	Juvenile bud 3	15.233
	CRR073306	Third green 1	2.046
	CRR073307	Third green 2	2.536
	CRR073308	Third green 3	3.125
	CRR073309	Second white 1	3.353
	CRR073310	Second white 2	3.719
	CRR073311	Second white 3	3.177
	CRR073312	Silver flowering 1	2.056
	CRR073313	Silver flowering 2	1.800
	CRR073314	Silver flowering 3	1.361
	CRR073315	Gold flowering 1	8.509
	CRR073316	Gold flowering 2	7.104
	CRR073317	Gold flowering 3	5.146
	CRR073318	Tawny withering 1	20.906
	CRR073319	Tawny withering 2	15.359
	CRR073320	Tawny withering 3	10.903