Gene detail

Detail information of GWHGAAZE023745

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	BAK61829.1	7.62346E-24	WRKY DNA-binding protein [Citrus unshiu]
Swissprot	tr\|Q8VWQ5\|WRK50_ARATH	3E-16	Probable WRKY transcription factor 50
trEMBL	tr\|F8WL84\|F8WL84_CITUN	3E-24	WRKY DNA-binding protein {ECO:0000313\|EMBL:BAK61829.1}
TAIR10	AT5G26170.1	1E-11	WRKY DNA-binding protein 50

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	24635074	24636384	+
GWHAAZE00000007	mRNA	24635074	24636384	+
GWHAAZE00000007	exon	24635074	24635437	+
GWHAAZE00000007	exon	24636056	24636384	+
GWHAAZE00000007	CDS	24635074	24635437	+
GWHAAZE00000007	CDS	24636056	24636195	+
GWHAAZE00000007	three_prime_UTR	24636196	24636384	+

Transcript Sequence
>GWHTAAZE023775 ATGAAGTTTCTTTCAACGTCCCAGGAAGGTAGCTGCGAACCCCCCACCCCCTGCCGGGTTATAGACGTGGGGACGATGATATATTTACACGACGAGGATGATCATATGGTTCTTCATAGTTCACAATCGTCAATGGCGGGTAATACTCGTGATGACGAAGACTCTGGCTTTAGACAATCACTAGAGCCGCAAGAGGGTGATTATGCAAACTTTGAGTTGTCAGAGCTTCTTGAGCTCGATGATTGGATTGAGGAAGAACCAACGTTGATGATCTCTGGGCACCCTCAGCAACCAATTTCTGCAGGAAGTGAAGCTGGTAGCTCCTCTGGACATAGTGGCAGCCATCTTCAAGGACCTAATACTGGGAATGGAGGGAATGGGGGAGATAGGAGCCAAACTAGAGTAGCCTTCAAAACAGAGTCGGCGATTGAAATCCTAGAAGATGGTTACAGGTGGAGGAAGTATGGGAAGAAGACGGTTAAAAACAGCCCACATCCAAGGTAAAGCAACTATTTTACCCCTAGTTATGTTGTCAACATACGTAGCATTTACACTTGTACTAACCACAATATTAAATGGAATAACAATCGCTCAACTTGAATACATACAAGTCCTTGCCTACATGGTTTGGGACACAGTTCAATTGACACACAAACATTGAATCATCATATCCGTCCTTGTCACATCTGACTT

Network for GWHGAAZE023745

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03106.16	WRKY	147	167	8.50E-07

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	WRKY

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.014
	SRR3591706	second leaf	0.922
	SRR3591707	mature leaf	4.247
	SRR3591708	Shoot apex	0.140
	SRR3591709	Stem	9.756
	SRR3591710	White floral bud	1.029
	SRR3591711	White flower	1.032
	SRR3591712	Green floral bud	1.794
	SRR3591713	Yellow flower	0.262
SRP173429	SRR8316895	Juvenile bud stage	3.892
	SRR8316896	Juvenile bud stage	3.839
	SRR8316897	Juvenile bud stage	3.057
	SRR8316894	Third green stage	1.146
	SRR8316900	Third green stage	1.991
	SRR8316901	Third green stage	4.283
	SRR8316898	Complete white stage	1.883
	SRR8316899	Complete white stage	5.559
	SRR8316903	Complete white stage	1.130
	SRR8316902	Silver flowering stage	0.151
	SRR8316904	Silver flowering stage	0.054
	SRR8316905	Silver flowering stage	0.486
	SRR8316906	Gold flowering stage	0.522
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.455
SRP132670	SRR6706286	Control	12.842
	SRR6706287	Light intensity 50%	11.590
	SRR6706288	Light intensity 20%	7.956
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.638
	CNS0095593	Slightly white alabastrum(diploid) 2	7.115
	CNS0095594	Slightly white alabastrum(diploid) 3	5.152
	CNS0095595	Whole white alabastrum(diploid) 2	1.711
	CNS0095596	Whole white alabastrum(diploid) 3	0.192
	CNS0095597	Whole white alabastrum(diploid) 4	1.029
	CNS0095598	Silvery flower (diploied) 1	1.315
	CNS0095599	Silvery flower (diploied) 2	1.189
	CNS0095600	Silvery flower (diploied) 3	0.275
	CNS0095601	Golden flower (diploid) 1	1.245
	CNS0095602	Golden flower (diploid) 2	0.967
	CNS0095603	Golden flower (diploid) 3	0.843
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.159
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.480
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.921
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.552
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.789
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.698
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.030
	CNS0095612	Silvery flower (tetraploid) 3	0.198
	CNS0095613	Golden flower (tetraploid) 1	0.056
	CNS0095614	Golden flower (tetraploid) 2	0.643
	CNS0095615	Golden flower (tetraploid) 3	0.021
CRA001975	CRR073297	Stem 1	1.678
	CRR073298	Stem 2	0.831
	CRR073299	Stem 3	0.623
	CRR073300	Leaf 1	2.712
	CRR073301	Leaf 2	2.344
	CRR073302	Leaf 3	2.053
	CRR073303	Juvenile bud 1	2.895
	CRR073304	Juvenile bud 2	3.327
	CRR073305	Juvenile bud 3	2.267
	CRR073306	Third green 1	0.507
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.130
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.404
	CRR073316	Gold flowering 2	4.567
	CRR073317	Gold flowering 3	2.340
	CRR073318	Tawny withering 1	2.620
	CRR073319	Tawny withering 2	4.822
	CRR073320	Tawny withering 3	4.116