Gene detail

Detail information of GWHGAAZE023744

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011019383.1	9.83258E-80	PREDICTED: 17.9 kDa class II heat shock protein-like [Populus euphratica]
COG	YP_004340108.1	6E-20	heat shock protein Hsp20
Swissprot	tr\|P05477\|HSP21_SOYBN	2E-78	17.9 kDa class II heat shock protein
trEMBL	tr\|B9RQT7\|B9RQT7_RICCO	1E-79	Heat-shock protein, putative {ECO:0000313\|EMBL:EEF46108.1}
TAIR10	AT5G12020.1	4E-35	17.6 kDa class II heat shock protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	24584068	24584541	+
GWHAAZE00000007	mRNA	24584068	24584541	+
GWHAAZE00000007	exon	24584068	24584541	+
GWHAAZE00000007	CDS	24584068	24584541	+

Transcript Sequence
>GWHTAAZE023774 ATGGATTTCAGGGTAATGGGATTCGACGAGCCGCTCTTCAACACCCTCCACCACATCCTCGACACGGCAGCCGACGATTCGTCAGACAAGAATTCCGGGCCGACCGGATCCTACGTACGGGACGCGAAGGCCATGGCTTCGACTCCGGCGGACGTGAAGGAATTCCCCAACTCCTACGTCTTCATCATCGACATGCCCGGACTCAAGTCCGGTGATATCAAGGTGCAGGTGGAAGATGACAAGGTGCTCGTGATAAGCGGAGAGAGGAAGCGAGAGGAGGAGAAAGAAGGCGCGAAGTATGTCAGGATGGAGAGGAGGATCGGGAAATTTATGAGGAAGTTTGTGCTTCCGGAGAATGCGAATACGGATAAGATTTCCGCGGTTTGTCAGGATGGGGTTTTGACGGTTATCGTGGAGAAGTTGCCGCCTCCGGAGCCGAAGAAGCCTAAGACTATTGAGGTTAAGATTGCTTAA

Network for GWHGAAZE023744

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	51	155	3.60E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.828
	SRR3591706	second leaf	0.349
	SRR3591707	mature leaf	4.658
	SRR3591708	Shoot apex	0.436
	SRR3591709	Stem	6.703
	SRR3591710	White floral bud	1.063
	SRR3591711	White flower	2.222
	SRR3591712	Green floral bud	5.612
	SRR3591713	Yellow flower	0.147
SRP173429	SRR8316895	Juvenile bud stage	213.253
	SRR8316896	Juvenile bud stage	596.388
	SRR8316897	Juvenile bud stage	173.692
	SRR8316894	Third green stage	10.792
	SRR8316900	Third green stage	47.521
	SRR8316901	Third green stage	101.520
	SRR8316898	Complete white stage	4.400
	SRR8316899	Complete white stage	37.361
	SRR8316903	Complete white stage	8.147
	SRR8316902	Silver flowering stage	12.786
	SRR8316904	Silver flowering stage	7.263
	SRR8316905	Silver flowering stage	8.880
	SRR8316906	Gold flowering stage	38.935
	SRR8316907	Gold flowering stage	38.575
	SRR8316908	Gold flowering stage	25.084
SRP132670	SRR6706286	Control	50.935
	SRR6706287	Light intensity 50%	36.203
	SRR6706288	Light intensity 20%	34.215
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	41.335
	CNS0095593	Slightly white alabastrum(diploid) 2	40.200
	CNS0095594	Slightly white alabastrum(diploid) 3	37.739
	CNS0095595	Whole white alabastrum(diploid) 2	30.727
	CNS0095596	Whole white alabastrum(diploid) 3	24.121
	CNS0095597	Whole white alabastrum(diploid) 4	21.551
	CNS0095598	Silvery flower (diploied) 1	29.046
	CNS0095599	Silvery flower (diploied) 2	361.619
	CNS0095600	Silvery flower (diploied) 3	158.065
	CNS0095601	Golden flower (diploid) 1	666.119
	CNS0095602	Golden flower (diploid) 2	232.186
	CNS0095603	Golden flower (diploid) 3	235.103
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.029
	CNS0095606	Slightly white alabastrum(tetraploid) 3	29.964
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.460
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.052
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.309
	CNS0095610	Silvery flower (tetraploid) 1	8.264
	CNS0095611	Silvery flower (tetraploid) 2	16.852
	CNS0095612	Silvery flower (tetraploid) 3	25.193
	CNS0095613	Golden flower (tetraploid) 1	12.334
	CNS0095614	Golden flower (tetraploid) 2	10.598
	CNS0095615	Golden flower (tetraploid) 3	1.621
CRA001975	CRR073297	Stem 1	10.575
	CRR073298	Stem 2	3.673
	CRR073299	Stem 3	10.647
	CRR073300	Leaf 1	5.844
	CRR073301	Leaf 2	7.013
	CRR073302	Leaf 3	6.323
	CRR073303	Juvenile bud 1	6.597
	CRR073304	Juvenile bud 2	2.581
	CRR073305	Juvenile bud 3	6.347
	CRR073306	Third green 1	12.241
	CRR073307	Third green 2	16.677
	CRR073308	Third green 3	11.419
	CRR073309	Second white 1	2.696
	CRR073310	Second white 2	2.425
	CRR073311	Second white 3	0.531
	CRR073312	Silver flowering 1	1.745
	CRR073313	Silver flowering 2	2.124
	CRR073314	Silver flowering 3	0.958
	CRR073315	Gold flowering 1	10.761
	CRR073316	Gold flowering 2	7.695
	CRR073317	Gold flowering 3	12.217
	CRR073318	Tawny withering 1	4.628
	CRR073319	Tawny withering 2	5.692
	CRR073320	Tawny withering 3	11.961