Gene detail

Detail information of GWHGAAZE023724

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011019383.1	1.11195E-80	PREDICTED: 17.9 kDa class II heat shock protein-like [Populus euphratica]
COG	YP_004340108.1	1E-20	heat shock protein Hsp20
Swissprot	tr\|P05477\|HSP21_SOYBN	4E-79	17.9 kDa class II heat shock protein
trEMBL	tr\|B9RQT7\|B9RQT7_RICCO	2E-80	Heat-shock protein, putative {ECO:0000313\|EMBL:EEF46108.1}
TAIR10	AT5G12020.1	4E-35	17.6 kDa class II heat shock protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	23939116	23939589	+
GWHAAZE00000007	mRNA	23939116	23939589	+
GWHAAZE00000007	exon	23939116	23939589	+
GWHAAZE00000007	CDS	23939116	23939589	+

Transcript Sequence
>GWHTAAZE023754 ATGGATTTCAGGGTAATGGGATTCGACGAGCCGCTCTTCAACACCCTCCACCACATCCTCGACACGGCAGCCGACGATTCGTCAGACAAGAATTCCGGGCCGACCGGATCCTACGTACGGGACGCGAAGGCCATGGCTTCGACTCCGGCGGACGTGAAGGAATTCCCCAACTCCTACGTCTTCATCATCGACATGCCCGGACTCAAGTCCGGTGATATCAAGGTGCAGGTGGAAGATGACAAGGTGCTCGTGATAAGCGGAGAGAGGAAGCGAGAGGAGGAGAAAGAAGGCGCGAAGTATGTCAGGATGGAGAGGAGGATCGGGAAATTTATGAGGAAGTTTGTGCTTCCGGAGAATGCGAATACGGATAAGATTTCCGCGGTTTGTCAGGATGGGGTTTTGACGGTTACCGTGGAGAAGTTGCCGCCTCCGGAGCCGAAGAAGCCTAAGACTATTGAGGTTAAGATTGCTTAA

Network for GWHGAAZE023724

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	51	155	2.90E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.175
	SRR3591706	second leaf	1.356
	SRR3591707	mature leaf	9.468
	SRR3591708	Shoot apex	1.838
	SRR3591709	Stem	12.547
	SRR3591710	White floral bud	1.894
	SRR3591711	White flower	4.855
	SRR3591712	Green floral bud	10.744
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	210.333
	SRR8316896	Juvenile bud stage	590.832
	SRR8316897	Juvenile bud stage	224.469
	SRR8316894	Third green stage	9.271
	SRR8316900	Third green stage	47.555
	SRR8316901	Third green stage	95.735
	SRR8316898	Complete white stage	5.126
	SRR8316899	Complete white stage	33.112
	SRR8316903	Complete white stage	9.816
	SRR8316902	Silver flowering stage	14.880
	SRR8316904	Silver flowering stage	11.495
	SRR8316905	Silver flowering stage	10.471
	SRR8316906	Gold flowering stage	45.930
	SRR8316907	Gold flowering stage	48.437
	SRR8316908	Gold flowering stage	30.204
SRP132670	SRR6706286	Control	53.237
	SRR6706287	Light intensity 50%	36.238
	SRR6706288	Light intensity 20%	33.297
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.544
	CNS0095593	Slightly white alabastrum(diploid) 2	36.834
	CNS0095594	Slightly white alabastrum(diploid) 3	40.576
	CNS0095595	Whole white alabastrum(diploid) 2	30.527
	CNS0095596	Whole white alabastrum(diploid) 3	20.589
	CNS0095597	Whole white alabastrum(diploid) 4	20.035
	CNS0095598	Silvery flower (diploied) 1	27.837
	CNS0095599	Silvery flower (diploied) 2	365.110
	CNS0095600	Silvery flower (diploied) 3	171.126
	CNS0095601	Golden flower (diploid) 1	683.033
	CNS0095602	Golden flower (diploid) 2	234.453
	CNS0095603	Golden flower (diploid) 3	241.947
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.369
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.557
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.976
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.291
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.591
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.723
	CNS0095610	Silvery flower (tetraploid) 1	6.821
	CNS0095611	Silvery flower (tetraploid) 2	11.228
	CNS0095612	Silvery flower (tetraploid) 3	18.528
	CNS0095613	Golden flower (tetraploid) 1	6.786
	CNS0095614	Golden flower (tetraploid) 2	5.867
	CNS0095615	Golden flower (tetraploid) 3	0.754
CRA001975	CRR073297	Stem 1	9.913
	CRR073298	Stem 2	4.745
	CRR073299	Stem 3	8.054
	CRR073300	Leaf 1	6.060
	CRR073301	Leaf 2	6.067
	CRR073302	Leaf 3	5.959
	CRR073303	Juvenile bud 1	6.968
	CRR073304	Juvenile bud 2	3.270
	CRR073305	Juvenile bud 3	7.234
	CRR073306	Third green 1	14.241
	CRR073307	Third green 2	17.996
	CRR073308	Third green 3	11.010
	CRR073309	Second white 1	3.187
	CRR073310	Second white 2	2.716
	CRR073311	Second white 3	0.684
	CRR073312	Silver flowering 1	1.895
	CRR073313	Silver flowering 2	3.226
	CRR073314	Silver flowering 3	1.361
	CRR073315	Gold flowering 1	11.778
	CRR073316	Gold flowering 2	8.049
	CRR073317	Gold flowering 3	10.810
	CRR073318	Tawny withering 1	6.679
	CRR073319	Tawny withering 2	5.236
	CRR073320	Tawny withering 3	11.369