Gene detail

Detail information of GWHGAAZE023723

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011019383.1	9.57607E-80	PREDICTED: 17.9 kDa class II heat shock protein-like [Populus euphratica]
COG	YP_004340108.1	2E-21	heat shock protein Hsp20
Swissprot	tr\|P05477\|HSP21_SOYBN	1E-76	17.9 kDa class II heat shock protein
trEMBL	tr\|A9PA59\|A9PA59_POPTR	3E-79	Heat shock protein 17.7 {ECO:0000313\|EMBL:EEE92060.1}
TAIR10	AT5G12020.1	2E-36	17.6 kDa class II heat shock protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	23931900	23932376	+
GWHAAZE00000007	mRNA	23931900	23932376	+
GWHAAZE00000007	exon	23931900	23932376	+
GWHAAZE00000007	CDS	23931900	23932376	+

Transcript Sequence
>GWHTAAZE023753 ATGGATTTCAGGGTAATGGGATTCGACGCGCCGCTCATCAACACCCTCCACCATATCATCGACACCGCTGCCAACGAAGACTCCGTCGACAAGAACTCCGGCCCAACCAGATCCTACGTCCGAGACGCCAAGGCGATGGCTGCCACTCCGGCCGACGTGAAGGAATTACCCAACTCTTACGTCTTCATCATCGACATGCCTGGACTCAAGTCCGGCGACATCAAGGTGCAGGTGGAAGATGACAACGTGCTCGTGATAAGCGGGGAGAGGAAGCGGGAGGAGGAGAAGGAAGGTGCGAAGTATGTCAGGATGGAGAGGAGGATCGGGAAATTTATGAGGAAGTTTGTGCTTCCGGAGAATGCGAATACGGATAAGATTTCCGCTGTTTGTCAGGATGGGGTTTTGACGGTTACCGTGGAGAAGTTGCCTCCCCCGGAGCCGAAGAAGCCCAAGACTATCGAAGTTAAGATCGGTTAA

Network for GWHGAAZE023723

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	52	156	1.70E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.245
	SRR3591706	second leaf	0.801
	SRR3591707	mature leaf	0.966
	SRR3591708	Shoot apex	5.422
	SRR3591709	Stem	19.118
	SRR3591710	White floral bud	0.804
	SRR3591711	White flower	3.743
	SRR3591712	Green floral bud	4.861
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	338.777
	SRR8316896	Juvenile bud stage	624.871
	SRR8316897	Juvenile bud stage	449.251
	SRR8316894	Third green stage	10.651
	SRR8316900	Third green stage	28.951
	SRR8316901	Third green stage	97.210
	SRR8316898	Complete white stage	1.675
	SRR8316899	Complete white stage	8.039
	SRR8316903	Complete white stage	3.201
	SRR8316902	Silver flowering stage	19.015
	SRR8316904	Silver flowering stage	5.862
	SRR8316905	Silver flowering stage	7.388
	SRR8316906	Gold flowering stage	41.985
	SRR8316907	Gold flowering stage	52.114
	SRR8316908	Gold flowering stage	25.008
SRP132670	SRR6706286	Control	22.716
	SRR6706287	Light intensity 50%	10.226
	SRR6706288	Light intensity 20%	9.239
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.124
	CNS0095593	Slightly white alabastrum(diploid) 2	17.537
	CNS0095594	Slightly white alabastrum(diploid) 3	23.590
	CNS0095595	Whole white alabastrum(diploid) 2	17.907
	CNS0095596	Whole white alabastrum(diploid) 3	8.593
	CNS0095597	Whole white alabastrum(diploid) 4	16.935
	CNS0095598	Silvery flower (diploied) 1	11.909
	CNS0095599	Silvery flower (diploied) 2	382.846
	CNS0095600	Silvery flower (diploied) 3	165.851
	CNS0095601	Golden flower (diploid) 1	709.852
	CNS0095602	Golden flower (diploid) 2	257.786
	CNS0095603	Golden flower (diploid) 3	244.648
	CNS0095604	Slightly white alabastrum(tetraploid) 1	79.306
	CNS0095605	Slightly white alabastrum(tetraploid) 2	93.068
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.441
	CNS0095607	Whole white alabastrum(tetraploid) 1	43.557
	CNS0095608	Whole white alabastrum(tetraploid) 2	45.592
	CNS0095609	Whole white alabastrum(tetraploid) 3	53.495
	CNS0095610	Silvery flower (tetraploid) 1	13.320
	CNS0095611	Silvery flower (tetraploid) 2	25.595
	CNS0095612	Silvery flower (tetraploid) 3	217.022
	CNS0095613	Golden flower (tetraploid) 1	20.535
	CNS0095614	Golden flower (tetraploid) 2	10.595
	CNS0095615	Golden flower (tetraploid) 3	1.626
CRA001975	CRR073297	Stem 1	9.434
	CRR073298	Stem 2	7.060
	CRR073299	Stem 3	11.264
	CRR073300	Leaf 1	3.949
	CRR073301	Leaf 2	11.107
	CRR073302	Leaf 3	6.618
	CRR073303	Juvenile bud 1	6.085
	CRR073304	Juvenile bud 2	2.769
	CRR073305	Juvenile bud 3	4.479
	CRR073306	Third green 1	2.483
	CRR073307	Third green 2	2.913
	CRR073308	Third green 3	1.858
	CRR073309	Second white 1	11.076
	CRR073310	Second white 2	5.721
	CRR073311	Second white 3	9.082
	CRR073312	Silver flowering 1	13.109
	CRR073313	Silver flowering 2	5.574
	CRR073314	Silver flowering 3	2.929
	CRR073315	Gold flowering 1	12.337
	CRR073316	Gold flowering 2	13.727
	CRR073317	Gold flowering 3	20.975
	CRR073318	Tawny withering 1	24.809
	CRR073319	Tawny withering 2	12.856
	CRR073320	Tawny withering 3	27.064