Gene detail

Detail information of GWHGAAZE023588

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004244420.1	1.28566E-53	PREDICTED: disease resistance protein RPM1-like [Solanum lycopersicum]
Swissprot	tr\|Q39214\|RPM1_ARATH	9E-36	Disease resistance protein RPM1
trEMBL	tr\|M1BL11\|M1BL11_SOLTU	6E-53	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400047577}
TAIR10	AT3G07040.1	3E-32	NB-ARC domain-containing disease resistance protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	15813762	15814373	-
GWHAAZE00000007	mRNA	15813762	15814373	-
GWHAAZE00000007	exon	15813762	15814373	-
GWHAAZE00000007	CDS	15813762	15814373	-

Transcript Sequence
>GWHTAAZE023618 ATGAAACTCCTTCGCCACCTACTTGTAATGGCAACTAATGAGAATGAATTCCTCACACTAGACGCTCTACCACACTCATCCATTCCTCCGGTTCTTCGAAAGCTAACTTTAGTCGGAAGATTGAAAAGAGTGCCTTCTTGGTTTCCGTCACTTCGCAATATAATTTATTTGCATTTGCATTGGAGCCAATTGGCGGAGGAAGACCCCATTCAGTACATAAATGGGTTGCCCAATTTAGAGCACCTCGCTCTGGTGAATGCATACGACCGTGGGAAGGTAAAATTGTGCTTCTACGAAGGGTTCCCTAAGCTTCAAGACTTGTTCCTTGTTATTTTTCGTGATTTGGGCGAAATAATAATTGCTACTGGAGTGATGCCAAGTCTTGTACGCATGAAGCTACATGTTTGTGGTGAACTGAAGAAGGTGCCTCGGGGAATTGAACACCTCACCAAGCTCGAAGAATTGGGCCTGAAAGATGTTTCAGATGAACTAATTGATAGCATTCGAGGGGAACAAAGTGTTGATTATGCCAAGGTAAAGCACATCCCAGCGATCAATCATTCTTACAAGATTAATGGAAGACATGAGAATGAAAGCTTGTCCCGGGCATAA

Network for GWHGAAZE023588

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13457	RPM1, RPS3	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.541
	SRR3591706	second leaf	13.081
	SRR3591707	mature leaf	14.398
	SRR3591708	Shoot apex	7.028
	SRR3591709	Stem	0.954
	SRR3591710	White floral bud	7.017
	SRR3591711	White flower	4.310
	SRR3591712	Green floral bud	12.791
	SRR3591713	Yellow flower	2.266
SRP173429	SRR8316895	Juvenile bud stage	7.798
	SRR8316896	Juvenile bud stage	10.204
	SRR8316897	Juvenile bud stage	8.371
	SRR8316894	Third green stage	7.545
	SRR8316900	Third green stage	18.689
	SRR8316901	Third green stage	14.331
	SRR8316898	Complete white stage	4.120
	SRR8316899	Complete white stage	18.878
	SRR8316903	Complete white stage	8.280
	SRR8316902	Silver flowering stage	4.310
	SRR8316904	Silver flowering stage	7.102
	SRR8316905	Silver flowering stage	3.186
	SRR8316906	Gold flowering stage	7.041
	SRR8316907	Gold flowering stage	4.999
	SRR8316908	Gold flowering stage	11.632
SRP132670	SRR6706286	Control	9.722
	SRR6706287	Light intensity 50%	10.816
	SRR6706288	Light intensity 20%	12.565
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.385
	CNS0095593	Slightly white alabastrum(diploid) 2	27.252
	CNS0095594	Slightly white alabastrum(diploid) 3	9.265
	CNS0095595	Whole white alabastrum(diploid) 2	15.080
	CNS0095596	Whole white alabastrum(diploid) 3	15.397
	CNS0095597	Whole white alabastrum(diploid) 4	12.238
	CNS0095598	Silvery flower (diploied) 1	15.204
	CNS0095599	Silvery flower (diploied) 2	12.927
	CNS0095600	Silvery flower (diploied) 3	11.243
	CNS0095601	Golden flower (diploid) 1	6.809
	CNS0095602	Golden flower (diploid) 2	7.370
	CNS0095603	Golden flower (diploid) 3	6.971
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.504
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.510
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.880
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.706
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.058
	CNS0095610	Silvery flower (tetraploid) 1	9.656
	CNS0095611	Silvery flower (tetraploid) 2	10.062
	CNS0095612	Silvery flower (tetraploid) 3	9.115
	CNS0095613	Golden flower (tetraploid) 1	3.297
	CNS0095614	Golden flower (tetraploid) 2	6.151
	CNS0095615	Golden flower (tetraploid) 3	3.083
CRA001975	CRR073297	Stem 1	26.111
	CRR073298	Stem 2	21.843
	CRR073299	Stem 3	20.790
	CRR073300	Leaf 1	26.968
	CRR073301	Leaf 2	23.058
	CRR073302	Leaf 3	20.734
	CRR073303	Juvenile bud 1	14.105
	CRR073304	Juvenile bud 2	7.371
	CRR073305	Juvenile bud 3	13.669
	CRR073306	Third green 1	6.661
	CRR073307	Third green 2	7.218
	CRR073308	Third green 3	9.753
	CRR073309	Second white 1	5.456
	CRR073310	Second white 2	7.328
	CRR073311	Second white 3	2.926
	CRR073312	Silver flowering 1	1.539
	CRR073313	Silver flowering 2	1.522
	CRR073314	Silver flowering 3	2.974
	CRR073315	Gold flowering 1	12.476
	CRR073316	Gold flowering 2	20.838
	CRR073317	Gold flowering 3	15.972
	CRR073318	Tawny withering 1	3.157
	CRR073319	Tawny withering 2	4.526
	CRR073320	Tawny withering 3	1.487