Gene detail

Detail information of GWHGAAZE023565

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008448589.1	3.6545E-106	PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic [Cucumis melo]
COG	YP_002335031.1	7E-57	ATP-dependent Clp protease proteolytic subunit
Swissprot	tr\|Q94B60\|CLPP4_ARATH	4E-100	ATP-dependent Clp protease proteolytic subunit 4, chloroplastic (Precursor)
trEMBL	tr\|A0A061G8D9\|A0A061G8D9_THECC	5E-106	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	AT5G45390.1	3E-81	CLP protease P4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	14356591	14361823	+
GWHAAZE00000007	mRNA	14356591	14361823	+
GWHAAZE00000007	exon	14356591	14356895	+
GWHAAZE00000007	exon	14361340	14361823	+
GWHAAZE00000007	CDS	14356591	14356895	+
GWHAAZE00000007	CDS	14361340	14361823	+

Transcript Sequence
>GWHTAAZE023595 ATGCTCTTCTTCACTCAATCATTTCCCCAAATAACTAGTTCCACTAAAACCCTAGGTAATGGTGGATTAGGGTTCAACTTTGTACCACCACCAAGTGCTTTTATTTCGGCCACTACGGGGCCTAGGGGCACCCTCGAAACCGGAGACCCCATGGGGCTGTTGCTGAGGGAGAGAATGGTATTCGTACCGAGCGATATCGACGATTTCGGTGCTGATTGTCTTATCAGTCAGTTGCTGTTGTTGGATGCCCGGGATCCTGAAAAGGATATCAGAGTTTTTGTTAATTCTCGTGGTGGTTCAATGAGTTCAACAATGGCCATCTACGACGTGCTAAAGCTCGTGAGGGCCGATGTATCCACGATTGCCCTTGGGATTTCAGCATCGACGGCTTCCATAATCCTAGCGGGGGGCACGAAAGGGAAGAGGTATGCGATGCCCAACTCACGTATAATGATACACCAACCGCTTGGAGGTGTGGGCGGACAAGTATTAGATGTTGAAATTCAAACCGAAGAGCTCGTGGTTAGCAAGAGGAATGTGATTAGAATCTATTCAGAAGAGACTGGTCGCCAGCCCAGACAGGTCGAGAAAGATTTGGATAGGGACCGATATCTGTCTCCGATCGAAGCGCTCGAGTACGGCATAATTGACGGTGTTATTGACAGAGAAAGAATTATCCCACTTGTGCCCGTGCCCGACAGGGTGAACGCTACAATCACGGTCGCCTCAGTCAACAAGGATCAGAAGAAATTCTTGATTCCCGACATCCCTGATGATGAGATATATTAA

Network for GWHGAAZE023565

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	48	222	2.50E-65

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	110.710
	SRR3591706	second leaf	166.178
	SRR3591707	mature leaf	121.540
	SRR3591708	Shoot apex	180.909
	SRR3591709	Stem	50.432
	SRR3591710	White floral bud	126.458
	SRR3591711	White flower	178.782
	SRR3591712	Green floral bud	157.068
	SRR3591713	Yellow flower	258.926
SRP173429	SRR8316895	Juvenile bud stage	85.012
	SRR8316896	Juvenile bud stage	103.137
	SRR8316897	Juvenile bud stage	48.666
	SRR8316894	Third green stage	50.086
	SRR8316900	Third green stage	230.780
	SRR8316901	Third green stage	196.044
	SRR8316898	Complete white stage	92.448
	SRR8316899	Complete white stage	209.064
	SRR8316903	Complete white stage	97.966
	SRR8316902	Silver flowering stage	96.102
	SRR8316904	Silver flowering stage	108.646
	SRR8316905	Silver flowering stage	61.303
	SRR8316906	Gold flowering stage	223.171
	SRR8316907	Gold flowering stage	206.025
	SRR8316908	Gold flowering stage	214.323
SRP132670	SRR6706286	Control	212.501
	SRR6706287	Light intensity 50%	223.236
	SRR6706288	Light intensity 20%	247.757
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	102.209
	CNS0095593	Slightly white alabastrum(diploid) 2	107.558
	CNS0095594	Slightly white alabastrum(diploid) 3	81.386
	CNS0095595	Whole white alabastrum(diploid) 2	107.884
	CNS0095596	Whole white alabastrum(diploid) 3	119.111
	CNS0095597	Whole white alabastrum(diploid) 4	92.156
	CNS0095598	Silvery flower (diploied) 1	119.315
	CNS0095599	Silvery flower (diploied) 2	140.700
	CNS0095600	Silvery flower (diploied) 3	207.879
	CNS0095601	Golden flower (diploid) 1	136.598
	CNS0095602	Golden flower (diploid) 2	197.295
	CNS0095603	Golden flower (diploid) 3	199.229
	CNS0095604	Slightly white alabastrum(tetraploid) 1	100.397
	CNS0095605	Slightly white alabastrum(tetraploid) 2	101.956
	CNS0095606	Slightly white alabastrum(tetraploid) 3	157.045
	CNS0095607	Whole white alabastrum(tetraploid) 1	55.973
	CNS0095608	Whole white alabastrum(tetraploid) 2	70.294
	CNS0095609	Whole white alabastrum(tetraploid) 3	180.881
	CNS0095610	Silvery flower (tetraploid) 1	201.668
	CNS0095611	Silvery flower (tetraploid) 2	258.433
	CNS0095612	Silvery flower (tetraploid) 3	251.937
	CNS0095613	Golden flower (tetraploid) 1	225.619
	CNS0095614	Golden flower (tetraploid) 2	256.184
	CNS0095615	Golden flower (tetraploid) 3	274.641
CRA001975	CRR073297	Stem 1	141.974
	CRR073298	Stem 2	141.651
	CRR073299	Stem 3	181.904
	CRR073300	Leaf 1	171.419
	CRR073301	Leaf 2	178.620
	CRR073302	Leaf 3	233.033
	CRR073303	Juvenile bud 1	253.813
	CRR073304	Juvenile bud 2	286.795
	CRR073305	Juvenile bud 3	162.211
	CRR073306	Third green 1	219.295
	CRR073307	Third green 2	115.911
	CRR073308	Third green 3	143.825
	CRR073309	Second white 1	304.918
	CRR073310	Second white 2	210.447
	CRR073311	Second white 3	184.667
	CRR073312	Silver flowering 1	248.523
	CRR073313	Silver flowering 2	286.163
	CRR073314	Silver flowering 3	227.901
	CRR073315	Gold flowering 1	331.617
	CRR073316	Gold flowering 2	320.958
	CRR073317	Gold flowering 3	303.846
	CRR073318	Tawny withering 1	90.625
	CRR073319	Tawny withering 2	87.103
	CRR073320	Tawny withering 3	95.870