Gene detail

Detail information of GWHGAAZE023552

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007040781.1	1.06419E-86	Homeodomain-like superfamily protein, putative [Theobroma cacao]
Swissprot	tr\|Q9SAK5\|APL_ARATH	2E-41	Myb family transcription factor APL
trEMBL	tr\|A0A061G803\|A0A061G803_THECC	4E-87	Homeodomain-like superfamily protein, putative {ECO:0000313\|EMBL:EOY25282.1}
TAIR10	AT5G45580.1	8E-47	Homeodomain-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	13357891	13362802	+
GWHAAZE00000007	mRNA	13357891	13362802	+
GWHAAZE00000007	exon	13357891	13358056	+
GWHAAZE00000007	exon	13359812	13359888	+
GWHAAZE00000007	exon	13359982	13360131	+
GWHAAZE00000007	exon	13362404	13362802	+
GWHAAZE00000007	CDS	13357891	13358056	+
GWHAAZE00000007	CDS	13359812	13359888	+
GWHAAZE00000007	CDS	13359982	13360131	+
GWHAAZE00000007	CDS	13362404	13362802	+

Transcript Sequence
>GWHTAAZE023582 ATGGATGGATTGTACGGCGGAGGTGGTGGCGGAGGTGGTGGGTATGATCCATACGAGAGTAGTGGAGGTGTAGTGATGACGAGAGACCCGAAGCCGCGGCTGAGATGGACGGCTGATCTTCACGATCAATTTGTCGACGCAGTTACTAAACTCGGAGGCCCTGACAAAGCGACTCCCAAATCTGTGCTAAGGTTGATGGGGCTGAAGGGATTGACATTGTACCATTTAAAGAGCCACTTACAGAAGTATAGACTTGGACAACAGGCCAGAAAACAGAACGAGGCAGATCGAACCAAAGAAAACAGCGGTGAGACCATTTTCATTTTTGATGACTATTTATTTAGAGGAAAATCTGTACGAAATGGTAACATAGTTTGCCTGTTTTCCACTTTGGTACAAACGAAGTTACAAATGAGAATAGAAACCCAAGGGAAGTACTTGCAAGCAATATTAGAGAAAGCGCAAACAAGCCTCTCCCTCGATATGAACTGCCCTGGCAGCTTAGAAGCAACAAGAAATCAACTAACCAACTTCAATTTAGCTCTCTCGAATCTCATGGAAAATTTAAATGGAGAAGAAAGGAACAATGGTAACATTATCGAGGGTGACAAACTTGACGCAAAGATCAACAGGAATGCGTCCATTTACGAGCAGATACACAAAGATGAGACGAAGAAGGATGTGAAGATTGAGGTTGAAGTAGGAGGATCCATTAATTTTGACTTGAATACAAGAGGTAGCTATGATTTTATTGGCATCAATGAAGCCAATGCAGCCTCATTTAGGAGATAG

Network for GWHGAAZE023552

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	34	84	2.90E-07
PF14379.7	Myb_CC_LHEQLE	132	156	1.50E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GARP-G2-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	36.224
	SRR3591706	second leaf	7.336
	SRR3591707	mature leaf	16.413
	SRR3591708	Shoot apex	6.848
	SRR3591709	Stem	41.982
	SRR3591710	White floral bud	18.814
	SRR3591711	White flower	18.497
	SRR3591712	Green floral bud	12.364
	SRR3591713	Yellow flower	25.356
SRP173429	SRR8316895	Juvenile bud stage	2.962
	SRR8316896	Juvenile bud stage	4.729
	SRR8316897	Juvenile bud stage	2.399
	SRR8316894	Third green stage	2.032
	SRR8316900	Third green stage	5.368
	SRR8316901	Third green stage	6.325
	SRR8316898	Complete white stage	3.134
	SRR8316899	Complete white stage	18.190
	SRR8316903	Complete white stage	5.597
	SRR8316902	Silver flowering stage	3.279
	SRR8316904	Silver flowering stage	3.754
	SRR8316905	Silver flowering stage	2.297
	SRR8316906	Gold flowering stage	8.832
	SRR8316907	Gold flowering stage	6.242
	SRR8316908	Gold flowering stage	10.252
SRP132670	SRR6706286	Control	7.626
	SRR6706287	Light intensity 50%	6.707
	SRR6706288	Light intensity 20%	5.965
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.587
	CNS0095593	Slightly white alabastrum(diploid) 2	8.637
	CNS0095594	Slightly white alabastrum(diploid) 3	6.662
	CNS0095595	Whole white alabastrum(diploid) 2	5.428
	CNS0095596	Whole white alabastrum(diploid) 3	4.400
	CNS0095597	Whole white alabastrum(diploid) 4	5.157
	CNS0095598	Silvery flower (diploied) 1	8.185
	CNS0095599	Silvery flower (diploied) 2	10.027
	CNS0095600	Silvery flower (diploied) 3	6.888
	CNS0095601	Golden flower (diploid) 1	8.508
	CNS0095602	Golden flower (diploid) 2	8.897
	CNS0095603	Golden flower (diploid) 3	8.409
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.433
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.263
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.424
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.279
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.926
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.459
	CNS0095610	Silvery flower (tetraploid) 1	5.569
	CNS0095611	Silvery flower (tetraploid) 2	5.673
	CNS0095612	Silvery flower (tetraploid) 3	1.635
	CNS0095613	Golden flower (tetraploid) 1	7.397
	CNS0095614	Golden flower (tetraploid) 2	6.869
	CNS0095615	Golden flower (tetraploid) 3	5.019
CRA001975	CRR073297	Stem 1	2.259
	CRR073298	Stem 2	3.420
	CRR073299	Stem 3	2.704
	CRR073300	Leaf 1	4.700
	CRR073301	Leaf 2	4.618
	CRR073302	Leaf 3	2.959
	CRR073303	Juvenile bud 1	5.698
	CRR073304	Juvenile bud 2	2.809
	CRR073305	Juvenile bud 3	5.305
	CRR073306	Third green 1	0.784
	CRR073307	Third green 2	0.766
	CRR073308	Third green 3	1.613
	CRR073309	Second white 1	0.670
	CRR073310	Second white 2	0.347
	CRR073311	Second white 3	0.277
	CRR073312	Silver flowering 1	0.502
	CRR073313	Silver flowering 2	0.296
	CRR073314	Silver flowering 3	0.192
	CRR073315	Gold flowering 1	6.304
	CRR073316	Gold flowering 2	6.645
	CRR073317	Gold flowering 3	3.471
	CRR073318	Tawny withering 1	12.374
	CRR073319	Tawny withering 2	16.824
	CRR073320	Tawny withering 3	13.201