Gene detail

Detail information of GWHGAAZE023545

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006599217.1	1.43398E-73	PREDICTED: DNA (cytosine-5)-methyltransferase CMT2-like isoform X3 [Glycine max]
COG	YP_510831.1	1E-11	DNA-cytosine methyltransferase
Swissprot	tr\|Q94F87\|CMT2_ARATH	1E-64	DNA (cytosine-5)-methyltransferase CMT2
trEMBL	tr\|K7MGE2\|K7MGE2_SOYBN	5E-74	Cytosine-specific methyltransferase {ECO:0000256\|RuleBase:RU000417}
TAIR10	AT4G19020.1	7E-57	chromomethylase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	13017707	13021225	+
GWHAAZE00000007	mRNA	13017707	13021225	+
GWHAAZE00000007	exon	13017707	13017844	+
GWHAAZE00000007	exon	13017921	13018022	+
GWHAAZE00000007	exon	13020622	13020665	+
GWHAAZE00000007	exon	13020748	13020817	+
GWHAAZE00000007	exon	13021094	13021225	+
GWHAAZE00000007	CDS	13017707	13017844	+
GWHAAZE00000007	CDS	13017921	13018022	+
GWHAAZE00000007	CDS	13020622	13020665	+
GWHAAZE00000007	CDS	13020748	13020817	+
GWHAAZE00000007	CDS	13021094	13021225	+

Transcript Sequence
>GWHTAAZE023575 ATGTTTCCTCCTTTAGAGATGATGGGTTGTGTATCCAATGGATATCAAGAAGTAAAACGTCCTGTACTATACGACCATAGGCCCTATCAATTGTCCGAGGATGATTACTTACGAGTTTGTCAAATTCCACGTAAAAAGGGAGCAAATTTCAGGGACTTACCGGGGGTGATTGTTAATGCTGACAATGTGGCTCTACGAGATCCAAAAGAGGAGCCACTACTTCCATCTGGAAAACGACTGGTACCCGATTATGTCTTCACTTTTGAAAAAGGGAAGTCGAAAAGGCCATTTGCAAGGTTGTGGTGGGATGAGACAGTGGCAACTGTAGTTACTTTTCCAAGTCTTCACAACCAGGCAGCATTACATCCGGAGCAGGACAGGGTCCTCACTCTGCGCGAGTATGCGAGGTTGCAGGGGTTTCCTGATTTTTATAGATTTTGCGGGACTGTCAAAGAAAGGTACGCAAGCCTTATATTCAATCTTTAA

Network for GWHGAAZE023545

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00145.18	DNA_methylase	116	154	1.10E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00558	DNMT1, dcm	Metabolic pathways	map01100
K00558	DNMT1, dcm	Cysteine and methionine metabolism	map00270

Gene Ontology

GO term	Ontology	Name
GO:0008168	molecular_function	methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.808
	SRR3591706	second leaf	4.668
	SRR3591707	mature leaf	0.217
	SRR3591708	Shoot apex	33.255
	SRR3591709	Stem	4.524
	SRR3591710	White floral bud	2.776
	SRR3591711	White flower	0.683
	SRR3591712	Green floral bud	6.880
	SRR3591713	Yellow flower	0.070
SRP173429	SRR8316895	Juvenile bud stage	4.997
	SRR8316896	Juvenile bud stage	6.397
	SRR8316897	Juvenile bud stage	3.989
	SRR8316894	Third green stage	2.995
	SRR8316900	Third green stage	9.175
	SRR8316901	Third green stage	9.675
	SRR8316898	Complete white stage	0.375
	SRR8316899	Complete white stage	6.694
	SRR8316903	Complete white stage	1.232
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.119
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.288
	SRR8316907	Gold flowering stage	0.145
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	7.070
	SRR6706287	Light intensity 50%	8.268
	SRR6706288	Light intensity 20%	10.232
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.251
	CNS0095593	Slightly white alabastrum(diploid) 2	13.919
	CNS0095594	Slightly white alabastrum(diploid) 3	11.343
	CNS0095595	Whole white alabastrum(diploid) 2	7.635
	CNS0095596	Whole white alabastrum(diploid) 3	9.450
	CNS0095597	Whole white alabastrum(diploid) 4	8.832
	CNS0095598	Silvery flower (diploied) 1	3.251
	CNS0095599	Silvery flower (diploied) 2	5.403
	CNS0095600	Silvery flower (diploied) 3	0.833
	CNS0095601	Golden flower (diploid) 1	1.109
	CNS0095602	Golden flower (diploid) 2	0.392
	CNS0095603	Golden flower (diploid) 3	0.359
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.695
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.264
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.871
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.579
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.247
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.415
	CNS0095610	Silvery flower (tetraploid) 1	0.177
	CNS0095611	Silvery flower (tetraploid) 2	0.464
	CNS0095612	Silvery flower (tetraploid) 3	0.281
	CNS0095613	Golden flower (tetraploid) 1	0.052
	CNS0095614	Golden flower (tetraploid) 2	0.158
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	5.281
	CRR073298	Stem 2	6.335
	CRR073299	Stem 3	5.095
	CRR073300	Leaf 1	8.938
	CRR073301	Leaf 2	9.316
	CRR073302	Leaf 3	5.994
	CRR073303	Juvenile bud 1	7.384
	CRR073304	Juvenile bud 2	4.085
	CRR073305	Juvenile bud 3	7.255
	CRR073306	Third green 1	0.581
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.905
	CRR073316	Gold flowering 2	0.109
	CRR073317	Gold flowering 3	0.290
	CRR073318	Tawny withering 1	5.912
	CRR073319	Tawny withering 2	2.484
	CRR073320	Tawny withering 3	9.202